1. CRISPRs and Tandem Repeats
A brief introduction & presentations by:
Ellen Korcovelos, Min Im, Shaun Norris, Michael Stueland

2. What are Tandem Repeats?
Tandem repeats are short units that repeat one after another
They are important in disease, inheritance/forensics
When we first sequenced a genome we had a bunch of nucleotides, which seemed random
Now we know better. Repeated sequences occur in a variety of patterns
Tandem repeats are when short units that repeat one after another

3. Well then what’s a CRISPR?
Clustered Regularly Interspersed Short Palindromic Repeats
Basically a special type of tandem repeat
They provide a genetic level of immunity of bacteria
CRISPRS and their associated protiens (Cas) provide interference for

4. A Project By: Shaun Norris
CRISPR Regions Relative to Gene Locations in Related Strains of Bacteria
A Project By: Shaun Norris

5. We know what CRISPRs are but...
We don’t know where they are!
But who cares? I mean what does gene location tell us?
We set out here to explore what genes/gene types surrounding CRISPR locations
It is known that CRISPRs are often associated with CAS proteins
The gene-centered view of evolution, gene selection theory, or selfish gene theory holds that adaptive evolutionoccurs through the differential survival of competing genes, increasing the frequency of those alleles whose phenotypiceffects successfully promote their own propagation, with gene defined as "not just one single physical bit of DNA [but] all replicas of a particular bit of DNA distributed throughout the world".[1] The proponents of this viewpoint argue that, since heritable information is passed from generation to generation almost exclusively by genetic material, natural selection and evolution are best considered from the perspective of genes.

6. How to...
Picked similar strains of Streptoccous/Staphlyoccous from Biobike
CRISPR finder on their sequences
Coordinates brought in to biobike and the genes surrounding theses sites were mapped

7. Results

8. Results

9. Results
It confirms that most CRISPR regions are associated with Cas proteins[1]

10. Discussion Not well automated presently
Analysis of more species is needed to provide a stronger conclusion
Results were reviewed for similarities - e.g. look for similar genes that surround these CRISPR regions

11. The Existence of common sharing CRISPR among Lactobacillus
Min Im

12. E. Coli According to Touchon et al (2010)
Common Sharing CRISPR in E.Coli strains
Repeat1: GGTTTATCCCCGCTGGCGCGGGGAACAC
Repeat2: GGTTTATCCCCGCTGGCGCGGGGAACTC
Repeat3: GTTCACTGCCGTACAGGCAGCTTAGAAA

13. Lactobacillus •Availablilty in Biobike –Lactobacillus-acidophilus-NCFM
–Lactobacillus-brevis-ATCC-367
–Lactobacillus-casei-ATCC-334
–Lactobacillus-delbrueckii-subsp-bulgaricus-ATCC-BAA-365
–Lactobacillus-gasseri
–Lactobacillus-johnsonii-NCC-533
–Lactobacillus-plantarum-WCFS1
–Lactobacillus-reuteri-F275

14. Lactobacillus-acidophilus-NCFM
Using “counts-of-k-mers.bike”
28-nt sequence with 15 repeats
with 61 spacers

15. Lactobacillus-brevis-ATCC-367
27-nt sequence with 13 repeats
with 18-nt spacers
26-nt sequence with 13 repeats

16. Can CRISPR be found in each other?
Lactobacillus-acidophilus
GGATCACCTCCACATACGTGGAGAAAAT (28-nt)
Lactobacillus-brevis
TTGCCGCTGAATCCGTCGTTGCCGCTG (27-nt)
TTGCCGCTGAATCCGTCGTTGCCGCT (26-nt)
None found each other…

17. Maybe... Different CRISPR in other Lactobacillus organisms
No common sharing CRISPR

18. Determination of Tandem Repeats in the Genomes of Two Strains of E
Determination of Tandem Repeats in the Genomes of Two Strains of E. coli and Their Bacteriophages
Ellen Korcovelos

19. Questioning what’s known
2 specific strains: Sakai and EDL933
Shiga-toxin (Stx1 and Stx2)
Toxin-encoding bacteriophages? With repeats?
Scientists have found two specific strains of O157:H7 that are associated with shiga-toxin producing agents. This toxin, when ingested by humans, causes diarrhea, and in worse scenarios, hemorrhagic colitis. In specifically focusing on tandem repeats within the E coli genome, I found that there are 6 known cases of tandem repeats within the two strains. After I saw this, I began to wonder if bacteria and the bacteriophages that infect them both contain the same repeats or portions of the same repeats.

20. Methods Find known repeated sequences Locate them in BioBIKE
Display string of repeats

21. Results Stx1 vs. EDL933 Stx2 vs. EDL933 Stx1 vs. Sakai Stx2 vs. Sakai
What to expect:
Contained the repeats → phages underwent recombination with the host
Partial repeats → evolutionary similarity with the host
If no repeats were found at all? Does the phage need these genes in the first place?

22. What does this tell us? Recombinance within the phage
Inserted sequences into host
None of the above

23. CRISPRS and Immunity
By: Michael Stueland

24. CRISPRs as an Immune Response
CRISPR's have two regions:
Direct repeat sequences
Variable spacer sequences
These sandwich each other.
Spacer sequences match closely with phage DNA
Derived CRISPR RNA (crRNA) can identify invading phage DNA

25. Are there any Bacterial CRISPRs that match known phage sequences?
If a spacer sequence matches a region on a phage genome, the bacteria has likely come in contact with that phage before.

26. First step: Find CRISPR regions
In order to do anything, a CRISPR region must first be identified.
CRISPR regions have repeating sequences between 23 to 47 base pairs[1].
So: if the repeating sequence can be found, then spacing sequences can also be found

27. First step: Find CRISPR regions
In Biobike, a genome can be scanned for any sequence that repeats multiple times.
However, repeat sequences need to be clustered.

28. Genome can be split into chunks, and each analyzed.
This gives ability to find clustered repeats.

29. Repeat sequence found in C. tetani
Green regions are repeats
Repeat = 30 base pairs
Variable regions range between 35 – 39 base pairs, 37.8 average

30. Step 2: Compare to phage genomes
Spacer sequence list acquired
Find similar matches by searching available phage genomes
Exact matches unlikely as viruses mutate rapidly, find similar sequences allowing for a few base pair differences

31. Possible match found Spacer sequence and Match:
AATGAAGTCAAATAATAACATACCATTTTGTGCTC
AATAATAACATACCATTTT
Chance of occurring randomly in genome the size of organism's: 9.18 x 10-7
Match: Prochlorococcus-phage
Unlikely C. tetani ran into this phage, as the bacterium it infects is a cyanobacterium that lives in the ocean.

32. Another CRISPR found Located in Nitrosomonas europaea
No Corresponding phage genome available

33. Another CRISPR sequence
Mycobacterium tuberculosis
Interesting feature: CRISPR interrupted by an unknown theoretical protein
Repeats each 35 BPs long

34. Viable Match

35. Viable match

36. Another Match

37. Phage genome

38. Finding:
Four likely matches between Bacterium in the mycobacterium genus and macobacterium phages found.
Probability of these occurring randomly very low
Likely that bacterium had encountered phage genomes in ancestory
Bacterium likely has some immunity to mycobacterium phages

39. References
[1] Horvath, P., Barrangou, R. January CRISPR/Cas, the Immune System of Bacteria and Archaea. Science. 327(5962):
Graphics taken from:Nakagawa labrtory website, and American Society for Microbiology website, questions-about-crisprs.html