1. Forensic DNA Analysis

2. DNA Analysis in Medicine
Every organism needs instructions to live, grow and reproduce
These instructions are encoded in long molecules of DNA
Each DNA molecule has a twisted ladder shape, known as a double helix

3. Summary Where is DNA? In the nucleus of cells; contain RNA/DNA
DNA – deoxyribonucleic acid
Nucleus has 23 pairs of chromosomes made up of DNA
Within each pair, one chromosome from sperm and one from egg

4. What makes DNA individual?
Forensic DNA Analysis
What makes DNA individual?
Four chemicals – adenine, guanine, cytosine, and thymine
These chemicals are strung together in a chain with alternating sugar and phosphate molecule
A is always paired with T
G is always paired with C

5. DNA
Human DNA is arranged into 23 pairs of chromosomes in the nucleus of each cell.
A full set of human chromosomes contains 6 billion pairs!
They code for only about 20,000 proteins
The bases that code for proteins are called genes. (The rest of DNA is non-coding)

6. DNA Human DNA is 95% similar to chimpanzee
Your DNA is 50% mother & 50% father
In humans we are 99.9% alike, in every 1,000 pairs, one will be different. That is what makes each persons DNA sequence unique! (exception-identical twins)

7. Criminal Investigations
DNA is like a fingerprint
Specimens – blood, hair, body fluid or skin
You can test the DNA, for forensics the highly variable regions are tested
These are called short tandem repeats, STR. The number of STRs at a particular location is known as an allele varies considerably from one person to another.

8. Techniques for Analyzing DNA
Karyotyping- looking for abnormalities in the chromosomes
Polymerase chain reaction- PCR important test in detecting genetic disorders. Allows profiling with extremely small samples by making millions of exact copies of a specific sequence

9. Techniques for Analyzing DNA
Gel electrophoresis – technique for separating molecules by length. Fragments are inserted into a special gel and electricity is applied, it results in a banded pattern that can be compared.
Microarrays- can detect thousands of genes at the same time. It is used in cancer to study which genes are active, or one base that is different from another.

10. Two main types (90s - Present):
Forensic DNA Analysis > History
Two main types (90s - Present):
Short Tandem Repeats (STRs)
Individual identification possible
Samples: Blood stains, semen
Mitochondrial DNA
Used in cases of severely degraded DNA
Individual identification not possible
Samples: Bones, hair shafts

11. Short Tandem Repeats (STRs)
Forensic DNA Analysis > STR
Short Tandem Repeats (STRs)
Currently the most used of all forensic markers
Individual identification possible
Type of data used in the FBI CODIS database
People differ in length at these loci
Are located in the nuclear DNA (chromosomes)

12. Short Tandem Repeats (STRs)
Forensic DNA Analysis > STR
Short Tandem Repeats (STRs)
Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..
Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..

13. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC
Forensic DNA Analysis > STR
Locus or Loci:
Refers to the location on the chromosome.
Allele:
Refers to the type of DNA.
For STRs,
the allele will be the number of repeats.
CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

14. Example: Locus: D5S818 Alleles: 7,9 Forensic DNA Analysis > STR
Paternal chromosome 5
CCAGATAGATAGATAGATAGATAGATAGATCC
Maternal chromosome 5
CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

15. Basic Steps in Analysis
Forensic DNA Analysis > STR
Basic Steps in Analysis
Extraction:
Separates DNA from sample
Amplification or PCR:
Amplifies small portions of DNA (STR regions)
Separation:
Separates amplified fragments according to size.

16. PCR Hood

17. The Thermal Cycler
Amplifies DNA

18. FMBIO
Separates and Measures Amplified DNA

19. Forensic DNA Analysis > STR
Color image of gel

20. Black and white image of STR gel.
Forensic DNA Analysis > STR
Gel Electrophoresis
Black and white image of STR gel.
Samples will have one or two bands at each loci.

21. Separates and Measures Amplified DNA
ABI 310 Genetic Analyzer
Separates and Measures Amplified DNA

23. Capillary Electrophoresis
Forensic DNA Analysis > STR
Capillary Electrophoresis
Sample will have one or two peaks at each loci.

24. Compare to a ladder that has all peaks at each loci.
Forensic DNA Analysis > STR
Compare to a ladder that has all peaks at each loci.

26. DNA Profiles are compared
Forensic DNA Analysis > STR
DNA Profiles are compared
TPOX CSF1PO D5S818 D8S1179
Blood stain , , , ,8
Suspect 1 8, , , ,12
Suspect , , , ,12
Suspect 3 7, , , ,8

27. Forensic DNA (mitochondria)
Mitochondria - The powerhouse of the cell.
Mitochondria have
their own DNA
Mitochondria

28. Mitochondrial DNA Forensic DNA Analysis > Mitochondrial Ring of DNA
YES
Double Helix
YES
Chromosomes NO

29. Mitochondrial DNA is only 16,569 letters long
Forensic DNA Analysis > Mitochondrial
Mitochondrial DNA is only 16,569 letters long
[compared to 3 billion in nuclear DNA]
There is a 900 base pair region with a 1.7% difference [D loop]

30. MtDNA used for old or degraded samples
Forensic DNA Analysis > Mitochondrial
Nuclear DNA vs. Mitochondrial DNA
Double Helix
Double Helix
46 Chromosomes
One Ring
Multiple copies in each mitochondria
One copy per cell
Multiple mitochondria in each cell
MtDNA used for old or degraded samples

31. Different colored peaks correspond to a different base
Forensic DNA Analysis > Mitochondrial
Nuclear DNA: Length is measured
mtDNA: Sequence is examined
Different colored peaks correspond to a different base

32. AGCTAGATCGTTATTCCGAG
Forensic DNA Analysis > Mitochondrial
DNA Sequences are compared
AGCTAGATCGTTATTCCGAG
Hair Sample
AGCTAGATCGTTATTCCGAG
Victim
Conclusion: Hair may have come from the victim.

33. AGCTAGATTGTTATTCCGAG
Forensic DNA Analysis > Mitochondrial
DNA Sequences are compared
AGCTAGATTGTTATTCCGAG
Hair Sample
AGCTAGATCGTTATTCCGAG
Victim
Conclusion: Hair did not come from the victim.

34. AGCTAGATTGTTATTCCGAG
Forensic DNA Analysis > Mitochondrial
DNA Sequences are compared
AGCTAGATTGTTATTCCGAG
Cigarette
AGCTAGATCGTTATTCCGAG
Suspect #1
AGCTAGATTGTTATTCCGAG
Suspect #2
AGCTTGATTGTTATTCCGAG
Suspect #3
AGCTAGATTGTTATTCCGAG
Suspect #4
Conclusion: Cigarette could be from Suspect #2, Suspect #4 or other person with the same sequence.

35. DNA and Statistics The final result is presented as a statistic.
Do not say:
“The DNA in the bloodstain is John Doe’s DNA.”
Do say:
“The chance that another person has this DNA in the bloodstain is 1 in 300 billion.”