1. RNA and Protein Synthesis

3. RNA Ribonucleic Acid Contains a Ribose sugar Single Stranded
Contains Uracil instead of Thymine
Used as the template for protein production

4. Functions of RNA
Protein Synthesis- controls the assembly of amino acids into proteins
Messenger RNA- (mRNA) carries copies of instructions to other cell parts
Ribosomal RNA- (rRNA) proteins are assembled on ribosomes
Transfer RNA- (tRNA) transfers amino acids to the ribosomes and matches them to the coded mRNA message

5. RNA Synthesis
Transcription- segments of DNA serve as templates to produce complimentary RNA sequence
RNA Polymerase- binds to DNA during transcription and separates DNA strands, then it assembles nucleotides into complimentary strands of RNA
Promoters- signals RNA polymerase where to start making RNA
RNA Editing
Introns- Pieces of RNA that are cutout, must be cutout before they go into action
Exons- remaining pieces that are left over after the introns are cutout

6. RNA
DNA Transcription

7. WARM UP
1. I am a double stranded molecule that stores all genetic information, who am I?
DNA
2. I am a building block of DNA, who am I?
Nucleotide
3. What process is RNA responsible for?
Protein Synthesis

8. Genetic Code
Polypeptides- proteins that are made up by joining amino acids together into long chains
Specific amino acid sequences in a polypeptide determine the properties of different proteins
Genetic Code- read three letters at a time, so that each codon is three bases long and corresponds to a single amino acid.
Codon- consists of three consecutive bases that specify a single amino acid to be added to a polypeptide chain

9. How do I read codons?

10. Practice Decode this RNA sequence. AUGGGAUCACACAGGGUCUUGUAA METHIONINE
GLYCINE
SERINE
HISTIDINE
ARGININE
VALINE
LEUCINE
STOP

11. Start and Stop Codons
AUG- Initial start codon, serves as the initiation of the sequence
UGA, UAG and UAA- encode for stop codons which ends the translation of amino acids

12. Translation
Ribosomes use the sequence of codons in the mRNA to assemble amino acids into polypeptide chains
Translation- decoding of a mRNA into a protein
Anticodon- three unpaired bases of a tRNA molecule which is complementary to the mRNA codon

13. Steps in Translation 1. Transfer RNA
A. Beginning at AUG, the tRNA has an anticodon whose bases are complementary to the codon on the mRNA
B. Ribosome positions start codon in an area to attract the anticodon
C. tRNA binds to the methionine (AUG)
D. The following codon is also bound to its anticodon

14. Steps in Translation 2. The polypeptide “assembly line”
A. Ribosome joins two amino acids together
B. The bond is broken between the AUG and the tRNA
C. tRNA floats away from the ribosome allowing it to bind another tRNA
D. The ribosome moves from right to left binding new tRNA molecules and amino acids

15. Steps in Translation 3. Completing the Peptide
A. Continues until the ribosome reaches the stop codons
Once the peptide is complete the mRNA and the peptide are released from the ribosome.
Translation is complete!

16. “Central Dogma” The information transferred from DNA to RNA to Protein
Gene Expression- the way in which DNA, RNA and proteins are involved in putting genetic information into action in living cells