1. PCR of
Chloroplast DNA

2. Aims Explore process of PCR: theory / practical Applications of PCR
Investigate evolutionary relationships of plants
Curriculum links

3. PCR Polymerase Chain Reaction (PCR)
Allows selective amplification of any fragment of DNA providing the nucleotide sequences flanking the fragment are known
Finds a needle in the haystack and then produces a haystack of needles by selective amplification
Kary Mullis: Nobel Prize for Chemistry 1993

4. PCR

5. Plant PCR
The use of amplified chloroplast DNA (cpDNA) to investigate evolutionary relationships of common plants

6. Plant PCR
1998: Flowering plants re-classified according to similarities in DNA
Angiosperm Phylogeny Group
Genes for rubisco
- encoded in chloroplast DNA

7. Plant PCR Kenny Hamilton, Biology teacher, RSE Teaching Fellowship
Royal Society of Edinburgh, Scottish Executive
Kenny Hamilton, Biology teacher, RSE Teaching Fellowship
Science and Plants for Schools
Dr Craig Simpson - Scottish Crop Research Institute
Dr Jan Barfoot - Scottish Institute for Biotechnology Education
University of Edinburgh

8. Journal of Biological Education, 40

10. Plant PCR
Summary of the procedure
Diagram: Dean Madden, NCBE

11. Schedule for today Transfer of energy via ATP: meeting room
Plant PCR (1): Extraction of DNA from plant material
Pour gel
Transfer of energy via ATP: meeting room
Plant PCR (2): Purification of DNA from plant material
Plant PCR (3): Amplification of cpDNA
Immunity and Stem Cells: meeting room
Plant PCR (4): Gel electrophoresis of amplified products
Stain gels
Results, discussion

12. Plant PCR – Session 1
Diagram: Dean Madden, NCBE

13. (i) Extraction of DNA Traditional method
Mechanical breakdown of cell walls/membranes by homogenisation with sand
Chemical disruption of cellular membranes by addition of detergent (SDS)
EDTA chelates Mg++ ions, helps break up protein complexes
NaCl helps disrupt cells and precipitate DNA
Tris buffer maintains appropriate pH
Ethanol to precipitate DNA

14. (i) Extraction of DNA
FTA Cards – technology for processing nucleic acids invented by Professor Leigh Burgoyne of Flinders University
Flinders Technology Australia, Fast Track Analysis
Commercially obtained from Whatmans –contain SDS, TrisEDTA buffer and other proprietary reagents
Application in research, diagnostics, environmental science, forensics and DNA databases
Included in SAPS/NCBE PCR kit

15. Plant PCR (i) Extraction of DNA from plant material
FTA card – chemically treated paper matrix for the safe collection, transport, storage, purification and analysis of DNA.
DNA is extracted on to the paper matrix, purified and then amplified.

16. Plant PCR per 8 people Four FTA card Four backing boards
Four different plant materials (2 Brassicas, 2 non-Brassicas)
Four pestles
Four punches
per 8 people

17. Plant PCR
Place backing board between the back cover of the card and the absorbent layer.

18. Plant PCR
Place a piece of fresh plant material on to one box on the FTA card.
Ensure it does not extend outwith the box.
Close cover.

19. Plant PCR
Using a pestle, squash the leaf on to the card until moisture has soaked through to the back of the absorbent layer. Discard squashed plant material.
Try to keep the sample within the box.

20. Plant PCR
Make sure that moisture from the leaf has soaked through to the back of the paper.

21. Plant PCR
Have you labelled your samples?

22. Plant PCR
Leave cards open to dry.

23. Frosted panel on this side
Molten agarose
55–60 °C
Diagram: Dean Madden, NCBE

24. Meeting Room - Transfer of energy via ATP - 11:15 - 12:30

25. DNA within the chloroplast Stroma
Outer membrane
Inner membrane
DNA within the chloroplast
Stroma
Starch granule
Stroma lamellae
Lipid
globule
Granum
Diagram: Dean Madden, NCBE

26. Plant PCR Chloroplast DNA Self-replicating DNA, 120 – 220 kb pairs
Highly conserved gene order
Contains genes that encode for tRNA (highly conserved across species)
 nucleotide sequences identical in the chloroplast DNA of almost all higher plants
‘consensus’ or ‘universal’ oligonucleotide primers

27. Plant PCR Chloroplast DNA
higher frequency of mutations in non-coding stretches of cpDNA which lie between genes
 relatively high rates of evolutionary change
amplification of non-coding regions of DNA between genes may be used to show differences in the cpDNA of different populations

28. Amplification of DNA Three stages in amplification process
(1) Denaturation – by heating to 94°C - 98° C

29. Amplification of DNA Three stages in amplification process
(2) Annealing – of synthetic oligonucleotide primers to end of area to be copied at 64° C
primers
Taq polymerase

30. Amplification of DNA Three stages in amplification process
(3) Extension – of the strand by DNA polymerase from Thermus aquaticus at 72°C
These three steps are repeated many times, the quantity of DNA doubling with each cycle

31. Primers anneal to complementary sequences of bases Primers
Taq polymerase
Non-target DNA
Target DNA
50–65°C
Primers anneal to complementary
sequences of bases
Primers
72°C
Taq DNA polymerase
extends the DNA strands
94°C
Double-stranded DNA
is denatured
Diagram: Dean Madden, NCBE

32. Cycle 1
Cycle 2
Cycle 3 5| 3|

33. Plant PCR
Diagram: Dean Madden, NCBE

34. Plant PCR Soft rubber tubing HOLD HERE Do not touch the point! 100 µL
Yellow graduated tip
Measure to the top of each band
50 µL
20 µL
10 µL
Diagram: Dean Madden, NCBE

35. Plant PCR Microsyringe HOLD HERE Do not touch the tip! Graduated tip
Do not touch the point!
Graduated tip
Graduated tip
10 μL
10 µL
2 μL
2 µL
Diagram: Dean Madden, NCBE

36. (ii) Purification of DNA
Purification buffer
Commercial preparation, composition unknown but possibly contains SDS, Tris EDTA buffer
Removes naturally occurring agents that would inhibit the PCR. For example, compounds that contain heavy metals such as chlorophyll, and other proteins
TE-1 buffer (10 mM TrisHCl,0.1 mM Na2EDTA pH 8)
Removes SDS
Ensures correct pH

37. Plant PCR (ii) Purification of the extracted DNA
Use the punch in turn (cleaning between samples) so that each individual removes one disc – the DNA to be amplified is on the disc.
One Brassica and one non-Brassica per pair.
One of each sample or one of three samples + negative control (blank paper, one per card) per four people.
4 completed cards (4 samples), 4 punches per 8 people

38. Plant PCR
1. Place cutting/backing board (clean!) behind absorbent layer.
Place tip of the punch over the area to be sampled, press firmly and rotate to remove a paper disc Important – choose an area where the extract has soaked through to the back.
Clean punch between samples by removing a disc of paper from an extract-free area.

39. Plant PCR
2. Use a cocktail stick/ plastic ‘wire’ to transfer the disc from the punch into a labelled, clear 1.5 cm3 microcentrifuge tube.
Use a different cocktail stick / ‘wire’ for each sample!
Label sample!

40. Plant PCR 6. Repeat steps 3, 4 and 5
3. Add 100 l Purification Reagent to the disc. Different tips for different discs!
4. Close tube and flick tube to wash the disc. Ensure the disc remains in the liquid.
5. Remove and discard purification reagent.
6. Repeat steps 3, 4 and 5

41. Plant PCR 10. Repeat steps 7, 8 and 9
7. Use a fresh tip to add 100 l TE-1 buffer to the disc. Different tips for different discs!
8. Close tube and flick tube to wash the disc. Ensure the disc remains in the liquid.
9. Remove and discard buffer.
10. Repeat steps 7, 8 and 9

42. Plant PCR
Summary of the procedure
Diagram: Dean Madden, NCBE

43. Plant PCR -amplification
PCR Beads: each bead is designed for a single 25 l reaction, in which volume the final component concentrations are:
Taq polymerase ~2.5 units
dNTPs (dATP, dCTP, dGTP, dTTP) 0.2 mM each
TrisHCl (pH 9.0) 20 mM
KCl 50 mM
MgCl2 1.5 mM
PCR Primers
CHc primer (forward)
CHd primer (reverse)
Primers are diluted to a working concentration of 10 pmol/ l

44. Plant PCR Amplification of chloroplast DNA oligonucleotide primer5’ 3’
oligonucleotide primer
highly conserved region of cpDNA
variable (non-coding) region of cpDNA
CHc: 5’CGAAATCGGTAGACGCTACG3’
CHd: 5’GGGGATAGAGGGACTTGAAC3’
Primers

45. Plant PCR (iii) Amplification of cpDNA 1. Label PCR tube
PCR beads contain Taq poymerase, dNTPs, buffers, co-factors
2. Add reagents
4 l sterile deionised water
10 l CHc primer
10 l CHd primer

46. Plant PCR 3,4 Close PCR tube, flick – centrifuge if necessary.
5. Use clean forceps to transfer the disc from microtube to PCR tube. Ensure disc is submerged in the PCR reagents.
6.Close tube.

47. Plant PCR
8. Place in thermal cycler.

48. Repeat this three-step cycle 30 times
30 seconds
30 seconds
30 seconds
Repeat this three-step cycle 30 times
Diagram: Dean Madden, NCBE

49. Plant PCR
PCR cycle
94°C for two minutes to ensure maximum separation of the strands
Thirty cycles of:
94°C for 30 seconds
55°C for 30 seconds
72°C for 30 seconds (at final stage 2 minutes)
PCR product can now be refrigerated or frozen

50. Lunch Immunity and Stem Cells – meeting room

51. Plant PCR

52. Plant PCR Electrophoresis gel
distance moved varies according to length of DNA fragments
different sized fragments
- distantly related?
limitations

53. Plant PCR – session 3 Summary of the procedure
Diagram: Dean Madden, NCBE

54. Plant PCR
Pour 2–3 mm depth of buffer over the gel before you ease the comb out
Diagram: Dean Madden, NCBE

55. Plant PCR
(iv) Gel electrophoresis of PCR products – One gel tank per pair
Diagram: Dean Madden NCBE
1. Add 2 l loading dye to 8 l DNA ladder (lilac microtube). Mix and load all 10 l into well 1 in a 1.5% agarose gel.
Diagram: Dean Madden, NCBE

56. Plant PCR
2. Using a fresh tip, add 2 l loading dye to your amplified sample and mix well.
3. Load 10 l of the sample into a different well in the gel. Note sample/well!
4. Repeat step 3 for other PCR samples. Each gel tank should contain a ladder, two Brassicas, two non-Brassicas and one other or a negative control.

57. Plant PCR
Diagram: Dean Madden NCBE
Diagram: Dean Madden, NCBE

58. Place a comb over the tank to reduce evaporation
Direction of DNA movement
Direction of DNA movement
Courtesy of Dean Madden

59. Plant PCR

60. Plant PCR Gel electrophoresis
negatively charged DNA moves towards the anode
gel is porous
 small molecules travel through gel more easily than larger molecules
 in a given time, smaller DNA fragments travel further than larger DNA molecules through a gel

61. Area with DNA bands Wells Loading dye Area with DNA bands
Diagram: Dean Madden, NCBE

62. Tea / coffee – meeting room

63. Plant PCR – session 3 Summary of the procedure
Diagram: Dean Madden, NCBE

64. Plant PCR - staining
Positively-charged Azure A binds to the negatively-charged phosphate groups of the DNA
DNA
Diagram: Dean Madden, NCBE

65. Plant PCR - staining
Stain on for 4 minutes!

66. DNA ‘ruler’ or ‘ladder’
Diagram: Dean Madden, NCBE

67. Plant PCR
The distance moved on the gel by the amplified cpDNA varies according to its length.
Bands which move the same distance but which are from different plants indicate that the lengths of DNA amplified are the same. This may indicate that these plants are genetically similar.
To gain a more complete phylogenetic picture, many primer pairs would require to be used to provide comparisons over a greater range of the organisms’ DNA

68. SSERC Bulletin 233 Autumn 2010

69. Plant PCR
PCR cycle
94°C for two minutes to ensure maximum separation of the strands
20 / 25 / 30 cycles of:
94°C for 30 seconds
55°C for 30 seconds
72°C for 30 seconds (at final stage 2 minutes)

70. Repeat this three-step cycle 30 times
30 seconds
30 seconds
30 seconds
Repeat this three-step cycle 30 times
Diagram: Dean Madden, NCBE

72. Plant PCR
Summary of the procedure
Diagram: Dean Madden, NCBE

73. Plant PCR Higher Biology Higher Human Biology
Unit 1 Cell Biology d) Synthesis and release of proteins – the role of DNA, RNA and cellular organelles
Unit 2 Genetics and Adaptation: Selection and speciation
Unit 1, Cell function and inheritance b) protein synthesis: Role of DNA, RNA and cellular organelles
Higher Human Biology

74. Plant PCR Higher Biotechnology Advanced Higher Biology
Unit 1, Microbiology: b) 3. Copying and translating genes c) Genetic engineering
Unit 3, Biotechnology: b) 2.Clinical and forensic medicine applications
Cell and Molecular Biology: d) Applications of DNA Technology
Advanced Higher Biology

75. Plant PCR Revised Higher Biology Revised Higher Human Biology
Unit 1 DNA and the Genome
1 (b)(ii) Polymerase Chain Reaction (PCR)
1 (c) (i) Phylogenetics of molecular clocks
Unit 1 Human Cells
2 (d)(ii) Amplification and detection of DNA sequences
Revised Higher Human Biology

76. PCR CfE Higher Biology & CfE Higher Human Biology - common content
The structure and replication of DNA
Structure of DNA —….deoxyribose and phosphate at 3' and 5' ends of each strand.
Organisation of DNA —
…..Circular chromosome in mitochondria and chloroplasts of eukaryotes

77. Plant PCR Replication of DNA by DNA polymerase and primer.
Polymerase chain reaction (PCR) amplification of DNA using complementary primers for specific target sequences.
DNA heated to separate strands then cooled for primer binding. Heat-tolerant DNA polymerase then replicates the region of DNA. Repeated cycles of heating and cooling amplify this region of DNA.

78. Purpose of this practical work for students?