1. Widespread AAA mutations in liver cancer: What are the implications?
Steve Rozen and 黄伟添 (Alvin NG Wei Tian)
Director, Centre for Computational Biology
Professor of Cancer and Stem Cell Biology
Associate Dean of Research Informatics
Duke-NUS Medical School, Singapore
Presentation at 昆山杜克大学 / Duke Kunshan University
2018 Sept 3

2. Duke-NUS Medical School
Nonprofit partnership
Duke in North Carolina, USA
National University of Singapore (NUS)
SingHealth, largest public healthcare provider, 3 hospitals, 3,100 beds
60 MDs / year
15 PhD students / year
PhD program in biostatistics and bioinformatics:
tinyurl.com/dnus-ibb

3. Outline Background: AAA compounds, herbs, nephrotoxicity
Background: urothelial cancer and the AAA mutational signature
Results: Widespread but variable AAA exposure in liver tumours
Summary and important areas for future research

4. Outline Background: AAA compounds, herbs, nephrotoxicity
Background: urothelial cancer and the AAA mutational signature
Results: Widespread but variable AAA exposure in liver tumours
Summary and important areas for future research

5. Aristolochic acids and analogues “AAA”
Aristolochic acid IV
(AAIV)
Aristolochic acid I
(AAI, intensively studied)
Aristolochic acid II
(AAII)
AAI, AAII, AAIV in many 关木通，
广防己
Aristolactam I, proximal AAI mutagen
in many 细辛,
including roots/rhizome
Aristolactam-N-beta-D-glycoside
in some关木通
Ariskanin A
in some 关木通）
Aristolochic acids (AAI – most studied, also AAII, AAIV, in many 关木通)

6. Many herbal medicine traditions use AAA containing plants

7. Many herbal medicine traditions use AAA containing plants
Romania
India
Brazil

8. Adenine > Thymine mutations
Aristolochic acids metabolize to N-hydroxy-aristolactams and then acylnitrenium ions that form DNA adducts
Covalent
Bond to N6
Aristolactam
Adenine
Adenine DNA adducts
lead to
Adenine > Thymine mutations
Figure from Arlt, Striborova, Schmeiser, 2002, Mutagenesis 17:265

9. AAAs are nephrotoxins 1891 Also: Orfila, 1851
Dumic, 1954, “Horse Poisoning by ‘Birthwort’ (Aristolochia clematitis L.)”

10. Kidney damage from AAAs
Poon, 2013, doi: /scitranslmed
Nontreated versus AA-treated mouse kidney (hematoxylin and eosin staining, ×400; scale bars, 25 mm). At day 10, there was a dramatic accumulation of proteinaceous fluid within the tubules of the AA-treated kidney (*). At days 30 and 90, the tubular epithelial cells were necrotic and had collapsed, leaving the tubular basement membrane naked (#). There were few signs of regeneration. The glomeruli demonstrated ischemic shrinkage (arrowhead). At day 90, local inflammatory infiltration (arrow) was evident in the interstitium, and urothelial dysplasia had developed
Jadot, 2017, doi: /ijms
Evolution of structural abnormalities and collagen accumulation in experimental aristolochic acid nephropathy. Representative photographs of hemalun, Luxol fast blue and Periodic Acid Schiff stained kidney sections and Sirius Red stained kidney sections (400×) from CTL mice and mice intoxicated with AAI during four consecutive days. Necrotic tubules (+) with cell debris in tubular lumens; cystic tubules (triangles) Collagen I and III, highlighted by Sirius Red staining, accumulate in the interstitium of the kidney of AA-treated mice from Day 10 and even more at Day 20 reflecting the progression to CKD.
Poon, 2013, doi: /scitranslmed
Also, review: 1st section of Dickman and Grollman 2010
/B X
Jadot, 2017, doi: /ijms

11. AAA and nephrotoxicity
Reviewed in Jadot Int. J. Mol. Sci. 2017, doi: /ijms
One large study (300 patients), Yang et al., 2011, Nephrol Dial Transplant (2012) 27: 292–298, doi: /ndt/gfr291

12. Outline Background: AAA compounds, herbs, nephrotoxicity
Background: urothelial cancer and the AAA mutational signature
Results: Widespread but variable AAA exposure in liver tumours
Summary and important areas for future research

13. AAA exposure often causes upper tract urothelial cancer (UTUC)
First detected in the Belgian weight-loss clinic kidney failure victims (Nortier et al., 2000, NEJM 342:1686)
Subsequently confirmed in multiple studies, eg Chen et al., Int. J. Cancer: 133, 14–21 (2013)
UTUC was the cancer type in which we and others first were able to detect the AAA mutational signature

14. Slight digression: Technical basis for mutational signature analysis

15. MR Stratton et al. Nature 458, 719-724 (2009) doi:10.1038/nature07943
Cell divisions from the fertilized egg to a
single cell within a cancer ….
Somatic mutations are acquired by the cells over time
Cell nucleus
MR Stratton et al. Nature 458, (2009) doi: /nature07943

16. Cell divisions from the fertilized egg to a
single cell within a cancer ….
Somatic mutations are acquired by the cells over time
Cell nucleus
Harmless mutations in the genome
MR Stratton et al. Nature 458, (2009) doi: /nature07943

17. Cell divisions from the fertilized egg to a
single cell within a cancer ….
Somatic mutations are acquired by the cells over time
Cell nucleus
Harmless mutations in the genome
Oncogenic
mutations
and harmless
“passenger”
MR Stratton et al. Nature 458, (2009) doi: /nature07943

18. Cell divisions from the fertilized egg to a
single cell within a cancer ….
Somatic mutations are acquired by the cells over time
Cell nucleus
Harmless mutations in the genome
Oncogenic
mutations
and harmless
“passenger”
Multiple
oncogenic
mutations
and harmless passenger mutations
MR Stratton et al. Nature 458, (2009) doi: /nature07943

19. Cell divisions from the fertilized egg to a
single cell within a cancer ….
Somatic mutations are acquired by the cells over time
Cell nucleus
Harmless mutations in the genome
Oncogenic
mutations
and harmless
“passenger”
Multiple
oncogenic
mutations
and harmless passenger mutations
MR Stratton et al. Nature 458, (2009) doi: /nature07943

20. We Identify cancer specific somatic mutations by large-scale sequencing (NGS)
…ACGTCCTAGTCAAAATCGAGCC…
…ACGTCCTAGTCTAAATCGAGCC…

21. We Identify cancer specific somatic mutations by large-scale sequencing (NGS)
…ACGTCCTAGTCAAAATCGAGCC…
…ACGTCCTAGTCTAAATCGAGCC…
Somatic mutation from A > T
(in a CAA trinucleotide context, so CAA > CTA)

22. This is the data for mutational signature analysis
We look at all mutations (which are mostly passengers)
We want to know: what is changing the DNA? ?
We are not interested (for the moment) in how the changed DNA causes cancer

23. Cost per human genome (US $)
Mutation signature analysis enabled by cheap next generation sequencing of cancer genomes
$10 million
In 2007
US $700
today
10,000 X
drop in price
Cost per human genome (US $)
Year

24. Mutagens in some herbs: AAA
Aristolochic acid analogue
Herbs
Aristolochic acids and analogues
AAA
Covalent
Bond to N6
Adenine
Adenine is the chemical for the DNA letter A
Adducts cause A to T mutations

25. Mutational signature in an AA-exposed UTUC (upper tract urothelial carcinoma)
CAG>CTG
TAG>TTG
CAA>CTA
Poon et al, Science Translational Medicine, 2013

26. Mutational signature in an AA-exposed UTUC (upper tract urothelial carcinoma)
CAG>CTG
TAG>TTG
CAA>CTA
Exposed cell line
Poon et al, Science Translational Medicine, 2013

27. A few years ago (2013): AAA exposure in upper tract urothelial cancer and cells
Exposed cells

28. A year ago: AA exposure in multiple tumor types
Liver (China)
Bile duct (China, Singapore)
Kidney (Taiwan, Balkans)
Upper Tract Urothelial
(China, Belgium, Balkans)
Bladder (China, Singapore)
Poon et al., 2013 and subsequent data (liver - hepatocellular carcinoma [HCC])
Zou et al., 2015, Jusakul et al., 2017 (bile duct)
Scelo et al., 2014, Jelakovic et al., 2014 (Kidney/RCC)
Poon et al., 2013, Hoang et al., 2013, many others (UTUC)
Poon et al., 2015, others (Bladder)

29. Evidence that this signature is due to AA and analogues
Aristolochic acid signature in cell lines
Mutational spectra of many tumours dominated by this signature (the signature is often easy detect by inspection)
Signature associated with aristolactam adducts (kidney cancer, UTUC, intra- hepatic bile duct cancer)
Associated with UTUCs in aristolochic acid kidney failure patients
Associated with tumours in geographic regions with known high exposure to AAAs

30. Outline Background: AAA compounds, herbs, nephrotoxicity
Background: urothelial cancer and the AAA mutational signature
Results: Widespread but variable AAA exposure in liver tumours
Summary and important areas for future research

31. Taiwan a known hotspot for AAA exposure, but AAA in liver cancer not previously studied there

32. 78% of Taiwan liver cancers (HCCs) had the AA signature
Ng, Poon, et al., Oct 2017 DOI: /scitranslmed.aan6446

33. 78% of Taiwan liver cancers (HCCs) had the AA signature
Ng, Poon, et al., Oct 2017 DOI: /scitranslmed.aan6446

34. 78% of Taiwan liver cancers (HCCs) had the AA signature
Ng, Poon, et al., Oct 2017 DOI: /scitranslmed.aan6446

35. mSigAct signature presence test

36. mSigAct signature presence test

37. mSigAct signature presence test

38. mSigAct signature presence test

39. mSigAct signature presence test

40. Publicly available liver cancer mutation data from 1,400 HCCs
We can ask: How extensive is AAA exposure in liver cancer across the world?

41. Widespread AAA mutations – Asia most affected (Mayo clinic mostly Asian patients)
Ng, Poon, et al., Oct 2017 DOI: /scitranslmed.aan6446

44. Widespread AAA mutations – Asia most affected (Mayo clinic mostly Asian patients)
Ng, Poon, et al., Oct 2017 DOI: /scitranslmed.aan6446

45. Number of AAA mutations was extremely variable
North America
No information
Other SE Asia
Other China
Mayo Clinic
Vietnam
Taiwan
Europe
Korea
Japan
in tumours with the signature
AAA signature mutations
(mutations per megabase)

46. Number of affected known driver genes was extremely variable
in tumours in known driver genes
AAA signature mutations
(counts)
North America
No information
Other SE Asia
Other China
Mayo Clinic
Vietnam
Taiwan
Europe
Korea
Japan

47. Outline Background: AAA compounds, herbs, nephrotoxicity
Background: urothelial cancer and the AAA mutational signature
Results: Widespread but variable AAA exposure in liver tumours
Summary and important areas for future research

48. Main Points Liver mutation data indicate widespread exposure to AAAs
AAAs are known urinary tract carcinogens and kidney toxins
Prevalence of AAA-mutated HCCs varies by geographic location
Number of AAA mutations in affected tumours varies by geographic location

49. Hypothesis: AAA exposure may elevate risk of liver cancer
Evidence for:
Chen et al., 2018 (International Journal of Cancer, doi: /ijc.31544)
Study of ~800,000 hepatitis-B-infected patients who visited TCM clinics; level of exposure estimated from prescription records
Found linear relationship between dose and risk of HCC
In our study (Ng et al, 2017) the proportion of exposed HCCs was versus estimated 0.33 consuming AAA herbs (Hsieh, 2008)
AAA mutations affected many known cancer driver genes
Might be similar to aflatoxin, which interacts multiplicatively with hepatitis B infection to increase HCC risk

50. Important questions for future research
Is AAA exposure a risk factor for HCC in isolation? In conjunction with hepatitis? Dose-risk relationship?
Can non-invasive tests of AAA exposure be developed?
Which AAAs have the main impact on kidney failure, urinary tract cancer, and (possibly) liver and bile duct cancers?
Toxicodynamics? Effects of high dose for short period versus low dose for long period?
How are people being exposed? Which herbs? How prepared? Which AAAs?
Which aristolochic acids, aristolactams, and related compounds are in 细辛 roots? Stems and leaves? Which species?
Regional differences within China? Exposure in Africa, Latin America?

51. Acknowledgements
Chang Gung Memorial Hospital Sen-Yung Hsieh Hao-Yi Huang Ming-Chin Yu Po-Huang Lee Jacob See-Tong Pang
Singapore (Duke NUS, National Cancer Centre Singapore, and Johns Hopkins Singapore) Song Ling Poon Mi Ni Huang Jing Quan LIM Arnoud Boot Willie Yu Yuka Suzuki Saranya Thangaraju Cedric C. Y. Ng Patrick Tan Ben Tean Teh Alex Chang
Funding
Singapore National Medical Research Council
Singapore Ministry of Health via the Duke-NUS Signature Research Programmes
Chang Gung Medical Foundation

52. Thank you Questions?