1. Phenylthiocarbamide (PTC)
70% can taste PTC
Taste very bitter or tasteless
3 Single Nucleotide Polymorphisms (SNPs) in the TASR (tasting gene)
Dominant Trait!!
Heterozgygous can taste
Homozygous have more intense taste response

3. PCR: The Basic Steps

4. Need a Special DNA Polymerase: Taq
Isolated from thermophilic bacterium Thermus aquaticus found in Hot Springs in Yellowstone N. P.
Can survive in high temperatures
Polymerization occurs at high temperature

5. PCR Primers: You need a “Sense” Primer and an “Antisense” Primer
TTGGACTGACAGTAGATTGATAGATGATATGATGATGCAGCTAGCTAATCGACAACCTGACTGTCATCTAACTATCTACTATACTACTACGTCGATCGATTAGCTG

6. Primers: Essential for Taq Polymerase
Important that know the DNA sequence of your gene that you want to amplify
TTGGACTGACAGTAG (sense)
5’TTGGACTGACAGTAGATTGATAGATGATATGATGATGCAGCTAGCTAATCGAC
AACCTGACTGTCATCTAACTATCTACTATACTACTACGTCGATCGATTAGCTG 3’
(antisense)CGTCGATCGATTAGCTG

7. PCR allows exponential amplification of a very small of amount of DNA into large quantity

8. Steps of PCR: Overview
Two single-stranded DNA produced by heat denaturing of dsDNA template
Primers anneal (hybridize) to their complementary sequences containing the denatured ssDNA molecules
Taq polymerase (or similar enzyme) replicates the ssDNA segments to which the primers have annealed
Multiple rounds of amplification yield high amount of desired target sequence