1. Ion Torrent Semiconductor Sequencing
Mike Lelivelt, Ph.D., Director of Bioinformatics
The content provided herein may relate to products that have not been officially released and is subject to change without notice.

2. Confidential and Proprietary—DO NOT DUPLICATE
Who am I? – Mike Lelivelt
Ph.D. from Univ of N Carolina in Microbial Genetics
Post-Doc at Univ of WI Madison in Yeast Genomics
9 years at Affymetrix – software developer outreach
2 years at Partek – data anaylsis for arrays & NGS
3 years at Ion Torrent/Life Tech in bioinformatics
Familiar with the challenges of applying genomic scale assays into discrete, actionable decisions via software.
I’m here to educate about semiconductor sequencing.
I’m here to listen to your needs.
Confidential and Proprietary—DO NOT DUPLICATE

3. Confidential and Proprietary—DO NOT DUPLICATE
Opening thoughts…
"The wonderful thing about standards is that there are so many of them to choose from." –Andrew Tanenbaum
Driven more by the technology that we’d like to admit
Each technology platform serves multiple applications
A data standard implies a file format, but it’s really more about understanding data process flows
Broad scope of NGS will drive multi-marker haplotypes and introduces allele frequency measurements into the decision process.
Software is a tough business model. We’ll need to work together on this.
Confidential and Proprietary—DO NOT DUPLICATE

4. Simple Natural Chemistry
Eliminate source error:
Modified bases
Fluorescent bases
Laser detection
Eliminate read length limitations:
Unnatural bases
Protect/de-protect
Slow cycle time H+
Sequence is determined by measuring hydrogen ions released (1 per base added per DNA strand) during 2nd strand synthesis when complementary base (A, C, G or T) are sequentially incorporated by DNA polymerase.

5. Massively Parallel Post-Light Sequencing
The chip that see chemistry
Read clockwise from Wafer.
Ion Torrent chip manufacturing process leverages the cumulative investment in semiconductor manufacturing over the last 30 years. Chips are produced in std semiconductor factories (a.k.a. foundries) and are similar in design to CMOS image sensor chips found in iPhones and Blackberry’s. Wheras the image sensors collect photons. Ion Torrent chips collect Protons
Cross sectional view shows the Ion sensitive layer in green with the microwells on the top surface (3um) with the transistor stack underneath

6. Torrent Browser runs on Torrent Server
Local compute and storage with an integrated web interface
Torrent Server – hardware appliance
Torrent Browser – easy web access to Ion data
Plugins for secondary analysis e.g. variant calling
For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.

7. Data Flow Leverages Several Formats
Incorporation for
1 Flow (DAT)
Incorporation over
many flows (DAT)
Raw signals per flow (WELLS)
Processed incorporations (SFF),
but moving to unmapped BAM
Flow space converted to base space (FASTQ)
@7D8NM:4:9
GGGATCAGGCTGTCGAACGCGTGATTACATCTAGCTA +
TMAP
##FORMAT=<ID=DP,Number=1
##FORMAT=<ID=HQ,Number=2
#CHROM POS ID REF ALT QUAL FILTER
rs G A PASS
binary
TVC
Variant Call Format (VCF)
BAM 7 7

8. What is raw data? Do you really want it?
Process Description File Type chip chip chip
Raw Voltage Data
DAT
40 GB
180 GB
320 GB
Signal Processing
WELLS
1 GB
8 GB
12 GB
Base Calls - Flow
SSF/BAM
1 GB
5 GB
8 GB
Base Calls - Base
FASTQ
0.3 GB
1.5 GB
2 GB
Base Calls - Aligned
BAM
0.1 GB
0.6 GB
3.5 GB 8
*1.5 v run 200bp runs (440 flows, 110 cycles), Nov 2011

9. Confidential and Proprietary—DO NOT DUPLICATE
Questions to Address
Are allele calls alone sufficient to call HLA types?
Likely not. More data is usually better.
Should HLA software be required to call novel alleles?
Speak no evil. See no evil. Hear no evil.
But software will serve the market.
Should novel alleles be submitted to IMGT/HLA?
Balance between social curation & data security. More than just allele info?
How should data be formatted to handle NGS richness?
Format is a snapshot in time.
Confidential and Proprietary—DO NOT DUPLICATE

10. Confidential and Proprietary—DO NOT DUPLICATE
All products mentioned in this presentation are for Research Use Only, not intended for any animal or human therapeutic or diagnostic use.
Confidential and Proprietary—DO NOT DUPLICATE