Presentation is loading. Please wait.

Presentation is loading. Please wait.

Standardized and Scalable DNA Assembly

Similar presentations


Presentation on theme: "Standardized and Scalable DNA Assembly"— Presentation transcript:

1 Standardized and Scalable DNA Assembly
Gene Synthesis (Total Synthesis)‏ Automated Biobrick Assembly

2 Custom Gene Synthesis Services

3 Custom Gene Synthesis Services
All Methods begin with parallel oligonucleotide biosynthesis Many oligos are somehow combined in vitro into long double-stranded DNAs In common use for gene synthesis

4 The Registry of Parts Basic Parts Devices Promoters
Ribosome Binding Sites Open Reading Frames Terminators Devices A GFP Producing Device tetR RBS GFP Ter. Ter.

5 Biobrick Standard Assembly

6 Biobrick Standard Assembly
TCTAGAGAAAGAGGAGAAATACTAGT b0034 TCTAGATGCGTATAGCAGAA...TAATACTAGT c0010 TCTAGAGAAAGAGGAGAAATACTAGATGCGTATAG...TAATACTAGT b0034.c0010


Download ppt "Standardized and Scalable DNA Assembly"

Similar presentations


Ads by Google