Download presentation
Presentation is loading. Please wait.
1
Protein Synthesis Using DNA to Make Proteins
2
From gene to protein protein transcription translation
3
Bodies Cells DNA Bodies are made up of cells
All cells run on a set of instructions spelled out in DNA
4
DNA Cells Bodies How does DNA code for cells & bodies?
how are cells and bodies made from the instructions in DNA
5
DNA Proteins Cells Bodies
DNA has the information to build proteins Gene- section of DNA that codes for a specific protein proteins cells DNA gets all the glory, Proteins do all the work bodies
6
How do proteins do all the work?
proteins run living organisms a) enzymes control all chemical reactions in living organisms b) structure all living organisms are built out of proteins
7
Cell organization: A) DNA DNA is in the nucleus
genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus
8
Cell organization: B) Proteins chains of amino acids
made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome
9
Passing on DNA information
Need to get genetic information from nucleus (DNA) to cytoplasm need a copy of DNA = messenger RNA cytoplasm nucleus build proteins mRNA ribosome
10
From nucleus to cytoplasm
transcription DNA mRNA protein translation cytoplasm trait nucleus
11
DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded
G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded
12
Three Types of RNA:
13
Transcription: making RNA from DNA
DNA strand is the template (pattern) match bases U : A G : C Enzyme used RNA polymerase
14
Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T
15
Matching bases of DNA & RNA
Double stranded DNA unzips using RNA polymerase T G G T A C A G C T A G T C A T C G T A C C G T
16
Matching bases of DNA & RNA
Match RNA bases to a portion of DNA bases on one side of DNA Uses RNA polymerase C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T
17
mRNA is made one nucleotide at a time, following base pairing rules
18
How does mRNA code for proteins?
mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How?
21
The mRNA code Each codon codes for one amino acid Code has duplicates
several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG
23
How are the codons matched to amino acids?
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases
26
Protein Synthesis animation
aa From gene to protein Protein Synthesis animation transcription translation DNA mRNA protein ribosome U C A G cytoplasm trait nucleus
27
cytoplasm protein transcription translation nucleus trait
29
Protein Synthesis Video-
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.