Download presentation
Presentation is loading. Please wait.
1
Quiz#10 LC710 10/27/10 name___________
Given the following transgenes co-existing in the same animal. rtta binds DNA if Dox is present CMVp rtta I.R.E.S GFP tetO TATA RFP Q1 0.5 pt (circle one) : Q2 0.5 pt (circle one) : Cellular Fluorescence observed prior to addition of Doxycycline is: Red Green Both Neither Cellular Fluorescence observed after addition of Doxycycline is: Red Green Both Neither Q3: 1pt What does tta do in the absence of Dox?________________________ What does tta do in the presence of Dox?________________________
2
the brain expressing Pax6 and/or Hox1.
Given the following transgenes co-existing in the same animal. 4 3 8 Pax6p 2 7 12 CreERt2 I.R.E.S GFP 11 1 6 Hox1p 5 10 9 loxP-RFP-loxP-TOXIN Above are WT cells in the brain expressing Pax6 and/or Hox1. If expressed, TOXIN will Kill cells (disappear) Q4 (2pts) Q5 (2pts) Prior to addition of TAM, which Cells are: After TAM addition, which Cells are: Red only: Green only: Both: Neither: Red only: Green only: Both: Neither: TAM= TAMOXIFEN Q6 (2pts) : in the above transgene, loxP sites are in this orientation: ATAACTTCGTATAATGTATGCTATACGAAGTTAT = loxP sequence This experiment is actually poorly designed and the loxP sites need to oriented as follows: Hox1p Why?
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.