Presentation is loading. Please wait.

Presentation is loading. Please wait.

CHROMOSOME FUSION?.

Published byCaren Miles Modified over 6 years ago

Similar presentations

Presentation on theme: "CHROMOSOME FUSION?."— Presentation transcript:

1 CHROMOSOME FUSION?

2 WHAT IS MOST STRIKING HERE?
Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from three ape species.

3 Why are the chromosome tips colored?
WHY COLORED TIPS? Why are the chromosome tips colored?

4 CHROMOSOME PARTS Head Telomere All Chromosomes have telomeres at their ends (like shoelace aglets!) Centromere Tail Telomere Telomeres have a unique DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

5 Let’s Narrow Our Focus:
6 longest chromosomes of humans (Hu), matched with 7 chromosomes from chimpanzees ONLY (Ch)

6 MORE QUESTIONS… Why are TWO shorter chimp chromosomes needed to match our #2 chromosome? Could our #2 chromosome have formed by the FUSION of TWO shorter chromosomes found in chimpanzees today (#12 and #13)? LIKE THIS…?

7 Human #2 Chimp #13 Chimp #12

8 PREDICTION Chimp #13 If fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosome Human #2 Chimp #12 Fusion Area?

9 DNA Head Telomere DNA Sequence for Telomeres: ttagggttagggttaggg…
|||||||||||||||||| aatcccaatcccaatccc… Centromere NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Repeated times in each Telomere Tail Telomere

10 EXPECTATIONS What will you look for? tandem repeats in fusion area
Where will you look for them? middle of our chromosome #2 How can you look for them? search online DNA database What if evidence is NOT found? fusion may not have happened

11 Do the lesson - Go online
CHROMOSOME FUSION Read the lesson Do the lesson - Go online Discuss the results Explanation? STOP HERE CONTINUE ONLY AFTER DOING LESSON or if there’s no time to do the lesson

12 STOP HERE (Results follow)

13 RESULTS agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

14 RESULTS CLARIFIED HEAD 13 HEAD 12
agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg HEAD 13 HEAD 12 See where the head-to-head fusion occurred?

15 DO THE LESSON, and find out!
WHY THE SUDDEN CHANGE? taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta HEAD 13 HEAD 12 Why do the TANDEM REPEATS suddenly change from ttaggg to ccctaa? Why so many slight variations in the number of t’s, a’s, g’s, and c’s in each repeat? DO THE LESSON, and find out!

16 WHY SO FEW REPEATS? gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg HEAD 13 HEAD 12 Count the TANDEM REPEATS in both telomere segments. (only about 37 ttaggg repeats in Head 13; about 88 ccctaa repeats in Head 12) Should be 800 to 1600 repeats, so… Why so many FEWER than typically found in telomeres? DO THE LESSON and find out!

17 Further Confirmation Comparison of DNA in Our Chrom. #2 with...

18 Another Confirmation Comparison of DNA in Our Chrom. #3 with...

19 Re-Check Banding Patterns
Compare other chromosomes online: Human with Chimp, Dog…

20 MULTIPLE EVIDENCE DO THE LABS! Compare hominoid chromosomes
Compare hominoid skulls Study pattern of hominid chronology Compare primate hemoglobins What do ALL of these patterns suggest? DO THE LABS!

Download ppt "CHROMOSOME FUSION?."

Similar presentations

Time to Abandon Darwin? Answering the Challenge from design Kenneth R. Miller Brown University.

Time to Abandon Darwin? Answering the Challenge from design Kenneth R. Miller Brown University.
Genome Organisation II Eukaryotic genomes are completely different in their organisation compared to prokaryotic, and also much bigger Their genes are.

Genome Organisation II Eukaryotic genomes are completely different in their organisation compared to prokaryotic, and also much bigger Their genes are.
Mystery of the Matching Marks 2 DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.

Mystery of the Matching Marks 2 DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.
Mystery of the Matching Marks (Part 3) 2 DNA Search Lab Followup Welcome back from your SEARCH FOR THE TELL-TALE TELOMERE Let’s see what it tells us…

Mystery of the Matching Marks (Part 3) 2 DNA Search Lab Followup Welcome back from your SEARCH FOR THE TELL-TALE TELOMERE Let’s see what it tells us…
Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC.

Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC.
Chromosomes and Diseases Genetics MBG-210. How many chromosomes in humans? Theophilus Painter in 1921 characterized the number of chromosomes as 24 on.

Chromosomes and Diseases Genetics MBG-210. How many chromosomes in humans? Theophilus Painter in 1921 characterized the number of chromosomes as 24 on.
CHROMOSOME FUSION?. WHAT IS MOST STRIKING HERE? Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from.

CHROMOSOME FUSION?. WHAT IS MOST STRIKING HERE? Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from.
Mystery of the Matching Marks part 2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you.

Mystery of the Matching Marks part 2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you.
Evidence of Evolution by Natural Selection

Evidence of Evolution by Natural Selection
More Historical Evidence The study of Homologies.

More Historical Evidence The study of Homologies.
Evolution: Fact and Theory  Fact: Species change over time.  Theory: Species arise from common descent through natural selection  Random mutations lead.

Evolution: Fact and Theory  Fact: Species change over time.  Theory: Species arise from common descent through natural selection  Random mutations lead.
Regents Biology 2006-2007 Witness to Evolution. Regents Biology Witness to Evolution  Peppered Moth  2 types: dark vs. light Peppered moth light.

Regents Biology Witness to Evolution. Regents Biology Witness to Evolution  Peppered Moth  2 types: dark vs. light Peppered moth light.
AP Biology 2007-2008 Evidence of Evolution by Natural Selection Testable Hypotheses.

AP Biology Evidence of Evolution by Natural Selection Testable Hypotheses.
AP Biology 2010-2011 Evidence of Evolution by Natural Selection Testable Hypotheses.

AP Biology Evidence of Evolution by Natural Selection Testable Hypotheses.
Does The Evidence Support Evolution? “More than a century ago, Darwin and Huxley posited that humans share recent common ancestors with the African great.

Does The Evidence Support Evolution? “More than a century ago, Darwin and Huxley posited that humans share recent common ancestors with the African great.
Evidence for Evolution

Evidence for Evolution
Mystery of the Matching Marks DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.

Mystery of the Matching Marks DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.
Lesson 4-5 LCM: Least Common Multiple. Multiples A multiple is formed by multiplying a given number by the counting numbers. The counting numbers are.

Lesson 4-5 LCM: Least Common Multiple. Multiples A multiple is formed by multiplying a given number by the counting numbers. The counting numbers are.
Are We Really Related to Chimps?

Are We Really Related to Chimps?
How Do Traits Get Passed On? LESSON 4. Move to which corner you think is correct for each question Can offspring get instructions for the variation of.

How Do Traits Get Passed On? LESSON 4. Move to which corner you think is correct for each question Can offspring get instructions for the variation of.

Similar presentations

Ads by Google