Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA Transcription / Translation

Similar presentations


Presentation on theme: "DNA Transcription / Translation"— Presentation transcript:

1 DNA Transcription / Translation
Jeopardy With your FAVORITE HOST… Ms. Ings

2 During translation, what molecule brings amino acids to the ribosome?
A. rRNA B. tRNA C. Enzymes D. mRNA

3 Ribosomes are made of A. Protein B. rRNA C. tRNA D. rRNA and Protein

4 Label this A. Codon B. Anticodon C. Terminator D. Promotor

5 During transcription A. Proteins are synthesized B. DNA is replicated
C. RNA is produced D. Translation occurs

6 The cap and Poly A tail are added during
A. Transcription B. Translation C. Replication D. RNA processing

7 What is a codon for Arginine?
A. AGC B. TAC C. AGC D. CGC

8 Transcribe this sequence: CTATCGG
A. CUAUCGG B. CATAGCC C. GAUAGCC D. CCGAUAG

9 Amino acids are bound by a ______ bond.
A. Ionic B. Peptide C. Polypeptide D. Hydrogen

10 Protein synthesis continues until
A. A stop codon is reached B. The termination sequence is reached C. The amino acid sequence runs out D. The end of the sequence is reached

11 A string of amino acids is called
A. Polypeptide B. Anticodon C. Codon D. Lipids

12 DNA is replicated from CCTAATA to CCTATA
DNA is replicated from CCTAATA to CCTATA. What type of mutation occurred? A. Point B. Addition C. Insertion D. Deletion

13 If AUG is the codon, what is the anticodon?
A. Methionine B. Threonine C. UAC D. TAC

14 What molecule is released when two amino acids bond?

15 Label this A. Ribosome B. RNA polymerase C. Nucleus D. DNA polymerase

16 A segment of DNA that codes for a protein is known as
A. purine B. phage C. gene D. pyrimidine

17 Label this A. Leading Strand B. Lagging Strand C. Template Strand
D. Non-Template Strand

18 Remove the intron (AUA) from the following DNA sequence. ACTATAGAT
A. ACTACAGAT B. ACTGAT C. UGAUAUCAU D. UGUCUA

19 Translate the following sequence… UCAAGU
A. methionine -tyrosine B. methionine-serine C. serine-serine D. Isoleucine - Valine

20 Where does translation occur?
A. Nucleus B. Nucleolus C. Cytoplasm D. Ribosome

21 What does the r in rRNA stand for?
A. Retro B. Ribose C. Ribosomal D. Retrograde

22 tRNA delivers _____ to growing polypeptide chains.
A. Protein B. mRNA C. Nucleotides D. Amino Acids

23 What is the DNA strand that made this mRNA strand? AUCCAU
A. ATCCAT B. AUGGAT C. TAGGTA D. ATGGAT

24 Polypeptide chains are typically
A. In a straight line B. Double stranded C. Forms bonds with itself D. Are 5 or less amino acids long

25 _____ sections of mRNA that code for a protein.
A. Exons B. tRNA C. rRNA D. DNA

26 Label this A. Ribosome B. Anticodon C. Start sequence D. Codon

27 What process is pictured below?
A. Replication B. Transcription C. Translation D. mRNA processing

28 UAA is a codon for A. Stop B. glycine C. phenylthalein D. Valine

29 Each amino acid only has _____ codon(s).
B. 1 C. up to 6 D. up to 20

30 Ribosomes are made of ____ subunits.
C. 4 D. 20

31 Letters : words as _____: Proteins
**FILL IN THE BLANK!**

32 The anticodon CAG codes for which amino acid?
A. Glutamine B. Serine C. Leucine D. Valine

33 In which part of the cell does this process shown take place?
A. In the nucleus B. In food vacuoles C. At the ribosomes D. On the chromosome

34 Transcription begins when RNA polymerase…
A. attaches to a ribosome. B. unwinds a strand of DNA. C. binds to a strand of RNA. D. attaches to the promoter sequence of a gene.

35 At the very beginning of translation, the first tRNA molecule…
A. binds to the mRNA’s anticodon. B. attaches directly to the DNA codon. C. connects an amino acid to its anticodon. D. binds to the mRNA’s start codon.

36 The tRNA that carries methionine binds to the ___ groove on the RNA.
A. A B. E C. P D. Both A and P

37 What part of the mRNA binds to the ribosome?
A. 3’ End B. 5’ End C. Poly A Tail D. Exons

38 BONUS QUESTION Transcribe, RNA process, and translate the following sequence Intron: CCG 3’ GATACGAGGGGCTTATCACT 5’


Download ppt "DNA Transcription / Translation"

Similar presentations


Ads by Google