1. National Agriculture Week 2007
1/18/2019
Title: Biology 3/22/07
Objectives:
To learn about how proteins are formed and the central dogma of biology.
Class Topics
Hand in W.S before the bell rings
Chapter 10 notes
RNA review
Protein synthesis
“Let the farmer forevermore be honored in his calling; for they who labor in the earth are the chosen people of God.”
Thomas Jefferson
National Agriculture Week 2007
Friday, January 18, :16 PM

2. Class Assignments Read 208-214 3/22/07 W.S. 10.1 3/22/07
1/18/2019
Class Assignments
What
By When
Read /22/07
W.S /22/07
W.S (SS/DL) 4/2/07
Chapter 10 Quiz 1 4/4/07
Due this class period
Due next class period
Due in the future

3. 1/18/2019
Grade Sheet
2A – p. 157 (5 pts.)

4. RNA Ribonucleic Acid Carries out the instructions coded for by DNA
1/18/2019
Ribonucleic Acid
Carries out the instructions coded for by DNA
Differences between RNA and DNA
Ribose is the sugar
Single stranded
Uracil - not thymine - bonds with Adenine
RNA

5. Types of RNA Messenger RNA Transfer RNA Ribosomal RNA
1/18/2019
Messenger RNA
mRNA takes DNA “instructions” to ribosomes
Transfer RNA
tRNA brings amino acids to ribosomes
Ribosomal RNA
rRNA makes up a part of each ribosome
Types of RNA

6. Protein Synthesis Proteins are manufactured on ribosomes
1/18/2019
Proteins are manufactured on ribosomes
Proteins are made from polypeptides
Polypeptides are made from the 20 amino acids (monomer of protein)
The order and number of amino acids determines the protein’s properties
DNA determines the order of amino acids because it’s the template
Protein Synthesis

7. Genetic Code Language of instructions for DNA and RNA
1/18/2019
Language of instructions for DNA and RNA
Only 4 letters (ACTG)- yet 20 amino acids
Is it read in groups of 1, 2, 3, or 4? 41 42 43 44
Genetic Code

8. 1/18/2019

9. Codons DNA is read in groups of 3 nucleotides - called a codon
1/18/2019
DNA is read in groups of 3 nucleotides - called a codon
Each codon represents an amino acid
AUGGGGUUUCACACUUGGUGA
Codons

10. Protein synthesis (Steps) Transcription
1/18/2019
1. RNA polymerase attaches to DNA
2. RNA pol. causes DNA to separate into 2 strands (unzip a short length)
3. DNA makes mRNA (transcription)
mRNA complementary bases attach to DNA
4. mRNA leaves nucleus - through nuclear pores
Protein synthesis (Steps) Transcription

11. Protein synthesis Translation
1/18/2019
5. mRNA travels down ER to area of ribosomes (or out to free-floating ribosomes)
6. Ribosome (rRNA and protein) moves along mRNA translating the message
7. tRNA brings appropriate amino acid to mRNA (at ribosome) - peptide bonds formed between amino acids
Appropriate amino acid determined by codon
Protein synthesis Translation
Virtual Cell Animation

12. From: http://esg-www.mit.edu:8001/
1/18/2019
8. tRNA leaves amino acid
9. Protein released
10. mRNA breaks apart
Central Dogma
Protein synthesis
From:
esgbio/dogma/dogma.html

13. 1/18/2019
Peptide bonds