Download presentation
Presentation is loading. Please wait.
Published byBernice Long Modified over 6 years ago
1
Protein Synthesis- What really happens inside the cell…
2
Proteins ________________________ (enzymes in chemical reactions)
Make up the majority of cell structures (organelles, muscles, skin) Control cell activities
3
2. Proteins are made up of smaller subunits called ___________________
Amino acids Amino Acid Amino Acid Amino Acid Amino Acid
4
Transcription (Step 1): Simplified as DNA mRNA
4
5
Where does Transcription Happen?
6
What happens? 1. Gene portion of DNA unzipped and
one strand used to rewrite DNA instructions into mRNA molecule 2. mRNA leaves the nucleus to find a ribosome 3. The DNA zips back up and is unchanged
8
What does transcription make?
mRNA
10
Sequence 1 – Human Insulin gene sequence
Transcribe each of these 2 sequence of DNA into mRNA (Remember A-U, T-A, G=C) Sequence 1 – Human Insulin gene sequence DNA: C C A T A G C A C G T T A C A A C G T G A A G G T A A mRNA: Sequence 2 – Cow Insulin gene sequence DNA: C C G T A G C A T G T T A C A A C G C G A A G G C A C G G U A U C
11
Translation (Step 2): Simplified as mRNA Protein
12
AUGCACAGAUCAAUUAGAUAA How many codons are there? _____
Key term- Codon A codon is every 3 bases in mRNA = 1 amino acid andthe the monkey said cheese AUGCACAGAUCAAUUAGAUAA How many codons are there? _____ How many amino acids will it code for? ______ mRNA Amino Acid Amino Acid
13
Where does translation happen?
Translation takes place on a ribosome in the cytoplasm
14
What happens? 1. The mRNA attaches to and is pulled through a ribosome 2. Each mRNA codon is read by both the ribosome and tRNA 3. tRNA brings/drops off the correct amino acids by matching its anticodon to the mRNA codon 4. The amino acids connect together in a chain to form a specific protein
16
What does translaiton make?
Amino Acid Amino Acid Amino Acid Amino Acid A PROTEIN!!!
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.