Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis- What really happens inside the cell…

Similar presentations


Presentation on theme: "Protein Synthesis- What really happens inside the cell…"— Presentation transcript:

1 Protein Synthesis- What really happens inside the cell…

2 Proteins ________________________ (enzymes in chemical reactions)
Make up the majority of cell structures (organelles, muscles, skin) Control cell activities

3 2. Proteins are made up of smaller subunits called ___________________
Amino acids Amino Acid Amino Acid Amino Acid Amino Acid

4 Transcription (Step 1): Simplified as DNA mRNA
4

5 Where does Transcription Happen?

6 What happens? 1. Gene portion of DNA unzipped and
one strand used to rewrite DNA instructions into mRNA molecule 2. mRNA leaves the nucleus to find a ribosome 3. The DNA zips back up and is unchanged

7

8 What does transcription make?
mRNA

9

10 Sequence 1 – Human Insulin gene sequence
Transcribe each of these 2 sequence of DNA into mRNA (Remember A-U, T-A, G=C) Sequence 1 – Human Insulin gene sequence DNA: C C A T A G C A C G T T A C A A C G T G A A G G T A A mRNA: Sequence 2 – Cow Insulin gene sequence DNA: C C G T A G C A T G T T A C A A C G C G A A G G C A C G G U A U C

11 Translation (Step 2): Simplified as mRNA Protein

12 AUGCACAGAUCAAUUAGAUAA How many codons are there? _____
Key term- Codon A codon is every 3 bases in mRNA = 1 amino acid andthe the monkey said cheese AUGCACAGAUCAAUUAGAUAA How many codons are there? _____ How many amino acids will it code for? ______ mRNA Amino Acid Amino Acid

13 Where does translation happen?
Translation takes place on a ribosome in the cytoplasm

14 What happens? 1. The mRNA attaches to and is pulled through a ribosome 2. Each mRNA codon is read by both the ribosome and tRNA 3. tRNA brings/drops off the correct amino acids by matching its anticodon to the mRNA codon 4. The amino acids connect together in a chain to form a specific protein

15

16 What does translaiton make?
Amino Acid Amino Acid Amino Acid Amino Acid A PROTEIN!!!

17

18


Download ppt "Protein Synthesis- What really happens inside the cell…"

Similar presentations


Ads by Google