Presentation is loading. Please wait.

Presentation is loading. Please wait.

Matthew 13:17 17 For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them;

Similar presentations


Presentation on theme: "Matthew 13:17 17 For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them;"— Presentation transcript:

1 Matthew 13:17 17 For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them; and to hear those things which ye hear, and have not heard them.

2 DNA Sequencing Timothy G. Standish, Ph. D.

3 Sequenced Genomes Over the past two years large-scale sequencing of eukaryotic genomes has become a reality Currently the sequencing of at least 4 multicelled eukaryotic genomes has been completed: 1998 Caenorhabditis elegans - 8 x 107 bp - A nematode worm 2000 Homo sapiens - 3 x 109 bp - Humans 2000 Arabidopsis thaliana x A plant related to mustard 2000 Drosophila melanogaster x 108 bp - Fruit flies

4 New Technology Rapid sequencing of large complex genomes has been made possible by: Foundational work done over many years and… Dramatic improvement in DNA sequencing technology over the past few years In this presentation we will look at both the basic principles of DNA sequencing and how techniques have been refined to yield the dramatic results we now see

5 Basic Principles

6 Dideoxynucleotides DNA Sequencing using the Sanger method involves the use of 2’3’-dideoxynucleotide triphosphates in addition to regular 2’-deoxynucleotide triphosphates Because 2’3’-dideoxynucleotide triphosphates lack a 3’ hydroxyl group, and DNA polymerization occurs only in the 3’ direction, once 2’3’-dideoxynucleotide triphosphates are incorporated, primer extension stops 2’-dideoxynucleotide monophosphate H P O OH HO CH2 NH2 N Sugar Base Phosphate 3’ 5’ 2’ 1’ 4’ H 2’3’-dideoxynucleotide monophosphate

7 2’3’ dideoxy-nucleotides Terminate DNA Replication
H OH P O CH2 CH3 HN N SUGAR-PHOSPHATE BACKBONE H P O HO CH2 OH NH2 N NH B A S E S O H P HO CH2 H2N N HN H P HO O CH2 N H2N H2O 2’3’dideoxynucleotide 2’3’ dideoxy-nucleotides Terminate DNA Replication

8 DNA Sequencing In DNA sequencing reactions all the basic components needed to replicate DNA are used 4 reactions are set up, each containing: DNA Polymerase Primer Template to be sequenced dNTPs A small amount of one ddNTP ddATP, ddCTP, ddGTP, ddTTP As incorporation of ddNTPs terminates DNA replication, a series of fragments is produced all terminating with the ddNTP that was added to each reaction

9 Plasmid (or phage) with cloned DNA fragment
DNA Sequencing Cloned fragment Primer Primer Binding sites Plasmid (or phage) with cloned DNA fragment

10 The ddATP Reaction 5’TTATCGTA 5’TTATCGTACCATGACTAGATGCGATA
Pol. 5’TTATCGTA Let me Through! Pol. 5’TTATCGTACCATGACTAGATGCGATA Agggg…. 3’AATAGCATGGTACTGATCTTACGCTAT5’ Pol. 5’TTATCGTACCATGA Oh come on! Pol. 5’TTATCGTACCATGACTAGA Not Again! 5’TTATCG 5’TTATCGTA 5’TTATCGTACCATGACTAGATGCGA 5’TTATCGTACCA 5’TTATCGTACCATGACTA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTAGATGCGATA

11 DNA Sequencing Products from 4 reactions each containing a small amount of a dideoxynucleotide are loaded onto a gel Polyacrlyamide gels capable of separating fragments differing in size by only one base High concentrations of urea are used to prevent formation of double-stranded DNA or secondary structures Because polymerization goes 5’ to 3’ shortest fragments are 5’ compared to longer fragments which are in the 3’ direction ddTTP ddCTP ddGTP ddATP Read 5’ to 3’ from bottom to top

12 DNA Sequencing What A Sequencing Autorad Actually Looks Like
A C G T DNA Sequencing What A Sequencing Autorad Actually Looks Like To read the autorad it is important to start at the bottom and work up so that it is read in the 5’ to 3’ direction 5’CTAGAGGATCCCCGGGTACCGAGCT...3’

13 The End


Download ppt "Matthew 13:17 17 For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them;"

Similar presentations


Ads by Google