1. DNA, Mitosis, & Meiosis Review

2. Nucleotide Base – Adenine, Thymine, Guanine, Cytosine, Uracil
Sugar – Deoxyribose(DNA) or Ribose (RNA)
Phosphate

3. It’s all about the… BASE PAIR RULE Adenine + Thymine
Cytosine + Guanine

4. DNA STRUCTURE

5. DNA
The order of the nucleotides is the determining factor in the expression of genes in organisms (your traits!)
AATGCTTAGGCTGCATTGGAAAACGTAAGTT

6. DNA Replication
DNA replication is the process through which cells copy DNA for transmission to daughter cells during cell division
The double helix structure allows DNA to easily unzip down the center between nitrogenous bases
Free floating nucleotides attach to each of the separated DNA strands forming 2 new strands of DNA, each an exact copy of the original

7. mutation
A mutation is an unexpected change in a DNA sequence, usually occurring during replication/division

8. DNA Chromosome: A compact spool of DNA Humans have 46 chromosomes
23 from father
23 from mother

9. DNA DIPLOID = two sets (full set) of DNA
Humans: 46 chromosomes – body cells for growth and repair
HAPLOID = one set (half set) of DNA
Humans: 23 chromosomes – gametes (sperm & eggs)

10. Parent Cell 2 Daughter Cells
The original cell is called the parent cell; 2 new cells are called daughter cells
Before cell division occurs , the cell replicates (copies) all of its DNA, so each daughter cell gets complete set of genetic information from parent cell
Each daughter cell is exactly like the parent cell – same kind and number of chromosomes as the original cell
2 Daughter Cells
Parent Cell

11. DNA
DNA is located in the nucleus and controls all cell activities including cell division
Long and thread-like DNA in a non-dividing cell is called chromatin
Doubled, coiled, short DNA in a dividing cell is called chromosome
Consists of 2 parts: chromatid and centromere

13. Coils up into chromosomes
Chromatin
Coils up into chromosomes
Duplicates itself

14. Mitosis
Mitosis – division of the nucleus into 2 nuclei, each with the same number of chromosomes
Mitosis occurs in all the somatic (body) cells

15. Phases Mitosis Meiosis Interphase Interphase I Prophase Prophase I
Metaphase
Anaphase
Telophase
Cytokinesis
Interphase I
Prophase I
Metaphase I
Anaphase I
Telophase I
Cytokinesis I
Prophase II
Metaphase II
Anaphase II
Telophase II
Cytokinesis II

16. Chromosome Appearance & Location
Phase
Chromosome Appearance & Location
Important Events
Interphase
Prophase
Metaphase
Anaphase
Telophase
Cytokinesis
DNA replication, cell grows and replicates organelles
DNA copies itself; chromatin
Nuclear envelope disappears, spindle fibers form
Chromosomes coil up
Chromosomes line up in the middle
Spindle fibers connect to chromosomes
Spindle fibers pull chromosome copies apart to opposite poles
Chromosome copies divide and move apart
Nuclear envelopes reform, 2 new nuclei are formed, spindle fibers disappear
Chromosomes uncoil back into chromatin
Division of the rest of the cell: cytoplasm and organelles
Chromatin

17. When chromatin scrunches together it is called a
chromosome

18. This spot that holds the 2 chromatid copies together is called a
centromere

19. Phase of the cell cycle
in which the nuclear membrane is present and DNA is spread out into chromatin.
interphase

20. Type of cell division that results in 2 identical daughter cells.
mitosis

21. This network of fibers that attach and pull the chromosomes apart are called______________
Spindle fibers

22. This cell is in __________________
prophase

23. This phase of the cell cycle is ______________
anaphase

24. This phase of the
cell cycle is
________________
metaphase

25. Phase of the cell cycle cell’s spend most of their time in.
interphase

26. Disorder in which body cells lose their ability to control cell division
cancer

27. One of 2 identical arms that make up a chromosome
chromatid

28. Phase of mitosis in which the nuclear membrane and nucleolus disappear and the DNA condenses into chromosomes.
prophase

29. These structures at the poles which attach to the spindle fibers and pull the chromosomes.
centrioles

30. This cell is in ___________
anaphase

31. This cell is in __________ telophase
The cell above is a _________ cell.
animal plant
Plant
You can see the cell plate forming in center instead of a cleavage furrow.

32. The very first dividing phase is _______________
prophase

33. Cleavage furrow This is called a This cell is _____________ cell.
an animal a plant
an animal Plants don’t have cleavage furrows.

34. Phase of mitosis where the cytoplasm splits into 2
CYTOKINESIS

35. Meiosis
Gametes (sperm/egg), on the other hand, contain only a single set of chromosomes
Thus, they have only a single set of genes
These cells are called haploid

36. Meiosis
Meiosis is a process of reduction division where the number of chromosomes per cell is cut in half through the separation of chromosomes

37. Meiosis
Each chromosome from mom pairs with it’s corresponding chromosome from dad
This structure is called a tetrad. Tetrads contain 4 chromatids.

38. Meiosis Crossing over –
during Meiosis I : Prophase I, when homologous chromosomes are paired together, there are points along the chromosomes that make contact with the other pair.
These points of contact can allow the exchange of genetic information between chromosomes.

39. Meiosis There’s NO chromosome replication before prophase II.
no interphase for Meiosis II
Cytokinesis I  Prophase II

40. Gamete Formation
In females, normally only 1 of the 4 haploid cells becomes an egg (has most of the cytoplasm).
The other 3 cells are called polar bodies and do not take part in reproduction

41. *In both mitosis and meiosis the cell divides.
Mitosis vs Meiosis
1 round of cell division
Results in 2 genetically identical daughter cells
Diploid= 2N
Somatic (body)Cells
2 rounds of cell division
Results in 4 different daughter cells
Haploid= N
Involved in gamete formation
*In both mitosis and meiosis the cell divides.