Presentation is loading. Please wait.

Presentation is loading. Please wait.

Enhancement of allergic inflammation by the interaction between diesel exhaust particles and the immune system  Andre E. Nel, MD, David Diaz-Sanchez,

Published byEstella Martin Modified over 5 years ago

Similar presentations

Presentation on theme: "Enhancement of allergic inflammation by the interaction between diesel exhaust particles and the immune system  Andre E. Nel, MD, David Diaz-Sanchez,"— Presentation transcript:

1 Enhancement of allergic inflammation by the interaction between diesel exhaust particles and the immune system  Andre E. Nel, MD, David Diaz-Sanchez, PhD, David Ng, BS, Timothy Hiura, BS, Andrew Saxon, MD  Journal of Allergy and Clinical Immunology  Volume 102, Issue 4, Pages (October 1998) DOI: /S (98) Copyright © 1998 Mosby, Inc. Terms and Conditions

2 Fig. 1 Chemical formulas of relevant polycyclic aromatic hydrocarbons, quinones, and other chemicals found in DEPs. Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

3 Fig. 2 Schematic showing mucosal targets of DEPs and contribution of these cells to allergic inflammation and IgE production. Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

4 Fig. 3 DEPs, β-NAF, and tBHQ induce CD80 expression in vivo and in vitro. A, RT-PCR analysis showing CD80 mRNA expression in nasal lavage cells obtained from 3 normal human subjects (S1, S2, and S3) before (–) and 18 hours after (+) intranasal challenge with 0.3 mg of DEPs Positive control mRNA was obtained from constitutively expressing Daudi B-cell line. RNA extraction, reverse transcription, and PCR analysis were performed with forward (CCTCTCCATTGTGATCCTG) and reverse (GGCGTACACTTTCCCTTCTC) primers as previously described.44,46 β-Actin primers were used to amplify message for household gene, which serves as internal standard. B, Flow cytometry analysis showing increased CD80 surface expression in THP-1 macrophage cell line treated with 50 μmol/L tBHQ or 1 μg/mL LPS for 48 hours. Cells were stained with a biotinylated anti-CD80 mAb followed by phycoerythrin-conjugated streptavidin. FACS analysis was performed in Bectin-Dickinson 2000 Analyzer. Rel. fluoers. intensity, Relative fluorescent intensity. C, RT-PCR analysis showing induction of CD80 mRNA in THP-1 cells by different amounts of tBHQ and β-NAF (μmol/L). RT-PCR analysis was performed as in A. Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

5 Fig. 4 Induction of IL-10 message by DEPs and tBHQ in vivo and in vitro. A, RT-PCR analysis to show cytokine mRNA expression in the THP-1 macrophage cell line treated with 50 μmol/L tBHQ, 50 μmol/L β-NAF, or 1 μg/mL LPS for 18 hours. RT-PCR analysis was performed as previously described.44,46 B, RT-PCR analysis showing synergy between tBHQ (10 μmol/L) and suboptimal dose of LPS (0.1 μmol/L) in induction of IL-10 message in THP-1 cells. Compare this with the inhibitory effect of tBHQ on IL-10 mRNA induction in RAW cells (see Fig 5). C, RT-PCR analysis to show IL-10 mRNA induction in nasal lavage cells obtained from 3 human subjects before (–) and 18 hours after (+) DEP challenge as previously described.44,46 Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

6 Fig. 5 tBHQ interferes in LPS-induced IL-10 mRNA expression in murine RAW macrophage cell line. A, RT-PCR analysis showing inhibition of IL-10, but not IL-6 or TNF-α, mRNA expression in RAW cells treated with either 50 μmol/L tBHQ, 1 μg/mL LPS, or a combination of both for indicated time periods. RT-PCR analyses were performed as previously described,44,46 with primers specific for respective murine cDNA sequences. B, Cytokine ELISA assays showing contrasting effects of tBHQ on IL-10 and TNF-α production in RAW cells during stimulation with 10 μg/mL LPS. Cells (5 × 106 ) cultured on 60-mm culture dishes in 3 mL of medium, were stimulated in absence or presence of 50 or 100 μmol/L tBHQ for 18 hours, and supernatants were collected for ELISA measurement by UMAB Cytokine Core Laboratory. C, Luciferase assay showing lack of tBHQ interference in LPS-induced IL-10 promoter-reporter gene activity by tBHQ. Sixteen hundred base pairs of human IL-10 promoter was inserted into the cloning site of pGL2B-Luc vector (generously proved by Dr Steven Smale at the University of California Los Angeles). Twenty micrograms of this plasmid was transfected into 7 × 106 RAW cells at 260 V and 950 μF. Cells were rested for 24 hours before addition of either 10 μg/mL LPS, 50 μmol/L tBHQ, or a combination of both stimuli for 24 hours. Cells were lysed, and luciferase assays were performed on 100 μg lysate with a commercial kit. Notice that although reporter gene activity was not affected by tBHQ, this chemical did inhibit mRNA expression by decreasing message half life (not shown). Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

7 Fig. 6 Schematic showing major metabolic pathways for DEP-derived PAHs and their quinone conversion products in mammalian cells. Notice that the 2 major metabolic pathways operate by means of distinct genetic response elements, which induce promoters of phase I and phase II drug metabolizing enzymes, respectively. Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

8 Fig. 7 Schematic to explain the differences between bifunctional and monofunctional inducers of antioxidant response element. Bifunctional agents require conversion to monofunctional homologue before induction of the ARE cascade. Bifunctional agents can only achieve this through CYP1A1 expression. Monofunctional inducers act independently of CYP1A1 by using induction of ROS to activate ARE. The insert (autoradiogram) shows an experiment in which human ARE sequence linked to CAT reporter gene was induced by bifunctional β-NAF or monofunctional tBHQ in transfected RAW cells. The increase in CAT activity is shown as fold stimulation by numbers above every lane. The insert also shows that induction of CAT activity can be reversed by an antioxidant, N-acetylcysteine. The transfection of RAW 264.7, stimulation with 50 μmol/L tBHQ or 50 μmol/L β-NAF, and performance of the CAT assay was accomplished as previously described.95 CAT Enz, CAT enzyme (used as positive control). Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

9 Fig. 8 Schematic showing participation of MAPK and NFκB kinase cascades in transcriptional activation of genes through AP-1 and NFκB response elements, respectively. The insert (autoradiogram) shows activation of JNK1 and JNK2 isoforms by 50 μmol/L tBHQ in RAW cells. The box on the left side of the diagram depicts phosphorylation of the JNK isoforms at an allosteric TPY motif by afferent kinases in this cascade. Phosphorylation of JNKs was detected by Western blotting employing an antiphosphopeptide antibody (New England Biolabs) and represents JNK activation. The box on the right side of the diagram shows Western blot for full-length JNK proteins to demonstrate that the chemical does not affect enzyme quantity. Cellular stimulation, extraction, and performance of Western blotting were done as previously described.95 Journal of Allergy and Clinical Immunology  , DOI: ( /S (98) ) Copyright © 1998 Mosby, Inc. Terms and Conditions

Download ppt "Enhancement of allergic inflammation by the interaction between diesel exhaust particles and the immune system  Andre E. Nel, MD, David Diaz-Sanchez,"

Similar presentations

Proinflammatory cytokine–induced and chemical mediator–induced IL-8 expression in human bronchial epithelial cells through p38 mitogen-activated protein.

Proinflammatory cytokine–induced and chemical mediator–induced IL-8 expression in human bronchial epithelial cells through p38 mitogen-activated protein.
Glucocorticoids Augment the Chemically Induced Production and Gene Expression of Interleukin-1α through NF-κB and AP-1 Activation in Murine Epidermal.

Glucocorticoids Augment the Chemically Induced Production and Gene Expression of Interleukin-1α through NF-κB and AP-1 Activation in Murine Epidermal.
Up-Regulation of Activating Transcription Factor-5 Suppresses SAP Expression to Activate T Cells in Hemophagocytic Syndrome Associated with Epstein-Barr.

Up-Regulation of Activating Transcription Factor-5 Suppresses SAP Expression to Activate T Cells in Hemophagocytic Syndrome Associated with Epstein-Barr.
Immune deficiency caused by impaired expression of nuclear factor-κB essential modifier (NEMO) because of a mutation in the 5′ untranslated region of.

Immune deficiency caused by impaired expression of nuclear factor-κB essential modifier (NEMO) because of a mutation in the 5′ untranslated region of.
Volume 9, Issue 5, Pages (November 1998)

Volume 9, Issue 5, Pages (November 1998)
Modulation by aspirin of nuclear phospho–signal transducer and activator of transcription 6 expression: Possible role in therapeutic benefit associated.

Modulation by aspirin of nuclear phospho–signal transducer and activator of transcription 6 expression: Possible role in therapeutic benefit associated.
Volume 134, Issue 4, Pages (April 2008)

Volume 134, Issue 4, Pages (April 2008)
Regulation of GM-CSF expression by the transcription factor c-Maf

Regulation of GM-CSF expression by the transcription factor c-Maf
Factors affecting the cytokine production of human T cells stimulated by different modes of activation  Yoshio Harada, MDa, Sumiko Watanabe, PhDa, Hans.

Factors affecting the cytokine production of human T cells stimulated by different modes of activation  Yoshio Harada, MDa, Sumiko Watanabe, PhDa, Hans.
Differentiation of CD4+ T Cells to Th1 Cells Requires MAP Kinase JNK2

Differentiation of CD4+ T Cells to Th1 Cells Requires MAP Kinase JNK2
Takashi Tanaka, Michelle A. Soriano, Michael J. Grusby  Immunity 

Takashi Tanaka, Michelle A. Soriano, Michael J. Grusby  Immunity 
Volume 25, Issue 6, Pages (December 2006)

Volume 25, Issue 6, Pages (December 2006)
Signal transduction pathways triggered by the FcϵRIIb receptor (CD23) in human monocytes lead to nuclear factor-κB activation  Rosa M. Ten, MD, PhDa,

Signal transduction pathways triggered by the FcϵRIIb receptor (CD23) in human monocytes lead to nuclear factor-κB activation  Rosa M. Ten, MD, PhDa,
Ting-ting Zhang, MSc, Klaus Okkenhaug, PhD, Baher F

Ting-ting Zhang, MSc, Klaus Okkenhaug, PhD, Baher F
Induction of B7-H1 and B7-DC expression on airway epithelial cells by the Toll-like receptor 3 agonist double-stranded RNA and human rhinovirus infection:

Induction of B7-H1 and B7-DC expression on airway epithelial cells by the Toll-like receptor 3 agonist double-stranded RNA and human rhinovirus infection:
Volume 9, Issue 1, Pages (January 2002)

Volume 9, Issue 1, Pages (January 2002)
CD40-mediated p38 mitogen-activated protein kinase activation is required for immunoglobulin class switch recombination to IgE  Ke Zhang, MD, PhD, Ling.

CD40-mediated p38 mitogen-activated protein kinase activation is required for immunoglobulin class switch recombination to IgE  Ke Zhang, MD, PhD, Ling.
Substance P Enhances the Production of Interferon-induced Protein of 10 kDa by Human Keratinocytes in Synergy with Interferon-γ  Naoko Kanda, Shinichi.

Substance P Enhances the Production of Interferon-induced Protein of 10 kDa by Human Keratinocytes in Synergy with Interferon-γ  Naoko Kanda, Shinichi.
LPS induces CD40 gene expression through the activation of NF-κB and STAT-1α in macrophages and microglia by Hongwei Qin, Cynthia A. Wilson, Sun Jung Lee,

LPS induces CD40 gene expression through the activation of NF-κB and STAT-1α in macrophages and microglia by Hongwei Qin, Cynthia A. Wilson, Sun Jung Lee,
Enhanced nasal cytokine production in human beings after in vivo challenge with diesel exhaust particles  David Diaz-Sanchez, PhD, Albert Tsien, MD, Adrian.

Enhanced nasal cytokine production in human beings after in vivo challenge with diesel exhaust particles  David Diaz-Sanchez, PhD, Albert Tsien, MD, Adrian.

Similar presentations

Ads by Google