Protein Synthesis Making Proteins

Protein Synthesis Making Proteins

copyright cmassengale
DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell copyright cmassengale

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded
G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Amino Acid Structure copyright cmassengale

DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER copyright cmassengale

Starting with DNA DNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESIS copyright cmassengale

Part I: Transcription Making mRNA from DNA
DNA strand is the template (pattern) pairing bases U : A G : C Enzyme RNA polymerase

Transcription Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box Specific base sequences act as signals to stop Called the termination signal copyright cmassengale

Pairing bases of DNA & RNA
Double stranded DNA unzips with RNA polymerase T G G T A C A G C T A G T C A T C G T A C C G T

Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Pair RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

RNA Polymerase copyright cmassengale

Remember the Complementary Bases
On DNA: A-T C-G On RNA: A-U copyright cmassengale

Question: What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’ copyright cmassengale

Answer: DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’ copyright cmassengale

Part II: mRNA Processing
After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain copyright cmassengale

mRNA Editing Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5” end of the newly copied mRNA A poly A tail is added to the 3’ end of the RNA The newly processed mRNA can then leave the nucleus copyright cmassengale

Result of Transcription
New Transcript Tail CAP copyright cmassengale

mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes copyright cmassengale

cytoplasm protein nucleus ribosome U C A G trait

Part III:Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins copyright cmassengale

How does mRNA code for proteins
mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA mRNA U C A G aa

How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code For ALL life! Code has duplicates Start codon
strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine copyright cmassengale

Name the Amino Acids GGG? UCA? CAU? GCA? AAA? copyright cmassengale

Step 1- Initiation mRNA transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit mRNA transcript copyright cmassengale

Ribosomes Large subunit P Site A Site mRNA A U G C Small subunit copyright cmassengale

Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids copyright cmassengale

Initiation 2-tRNA G aa2 A U 1-tRNA U A C aa1 anticodon A U G C U A C U U C G A hydrogen bonds codon mRNA copyright cmassengale

Elongation 3-tRNA G A aa3 peptide bond aa1 aa2 1-tRNA 2-tRNA anticodon U A C G A U A U G C U A C U U C G A hydrogen bonds codon mRNA copyright cmassengale

aa1 peptide bond 3-tRNA G A aa3 aa2 1-tRNA U A C (leaves) 2-tRNA G A U A U G C U A C U U C G A mRNA Ribosomes move over one codon copyright cmassengale

peptide bonds 4-tRNA G C U aa4 aa1 aa2 aa3 2-tRNA 3-tRNA G A U G A A A U G C U A C U U C G A A C U mRNA copyright cmassengale

peptide bonds 4-tRNA G C U aa4 aa1 aa2 aa3 2-tRNA G A U (leaves) 3-tRNA G A A A U G C U A C U U C G A A C U mRNA Ribosomes move over one codon copyright cmassengale

peptide bonds U G A 5-tRNA aa5 aa1 aa2 aa4 aa3 3-tRNA 4-tRNA G A A G C U G C U A C U U C G A A C U mRNA copyright cmassengale

peptide bonds U G A 5-tRNA aa5 aa1 aa2 aa3 aa4 3-tRNA G A A 4-tRNA G C U G C U A C U U C G A A C U mRNA Ribosomes move over one codon copyright cmassengale

aa5 aa4 aa199 Termination aa3 primary structure of a protein aa200 aa2 aa1 terminator or stop codon 200-tRNA A C U C A U G U U U A G mRNA copyright cmassengale

End Product –The Protein!
The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199 copyright cmassengale

Messenger RNA (mRNA) A U G C mRNA start codon codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 codon 1 methionine glycine serine isoleucine alanine stop codon protein Primary structure of a protein aa1 aa2 aa3 aa4 aa5 aa6 peptide bonds copyright cmassengale

Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon copyright cmassengale

Transfer RNA amino acid attachment site U A C anticodon copyright cmassengale

Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU copyright cmassengale

Transcription Transcription occurs when DNA acts as a template for mRNA synthesis. Translation occurs when the sequence of the mRNA codons determines the sequence of amino acids in a protein. Translation copyright cmassengale

Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A copyright cmassengale

Protein Synthesis Making Proteins

Similar presentations

Presentation on theme: "Protein Synthesis Making Proteins"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Protein Synthesis Making Proteins

Similar presentations

Presentation on theme: "Protein Synthesis Making Proteins"— Presentation transcript:

Similar presentations

About project

Feedback