Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis: Transcription

Similar presentations


Presentation on theme: "Protein Synthesis: Transcription"— Presentation transcript:

1 Protein Synthesis: Transcription
Explain the basic processes of transcription and translation, and how they result in the expression of genes. EQ: Why is the sequence of nucleotides in DNA so important?

2 Proteins Review Proteins are chains of amino acids = polypeptide
Proteins run living organisms Enzymes control all chemical reactions in living organisms Structure all living organisms are built out of proteins made by a “protein factory” in cytoplasm protein factory = ribosome In cytoplasm

3 Remember…. DNA is a genetic CODE. DNA is stored inside the nucleus
All organisms share same genetic code. DNA structure: Double Helix Nucleotides: A, T, C, G A-T C-G

4 Proteins and DNA DNA can code for making many different proteins
mRNA Proteins and DNA DNA can code for making many different proteins proteins make up physical features of our bodies How do we read the DNA code for making proteins? Protein synthesis! Each gene = new protein We read the DNA “code” in small sections (genes) when we need to make a new protein. (All the time!) Protein

5 Protein Synthesis 2 Main steps:
Synthesis = the process of building or making something Protein synthesis = the process of building proteins. 2 Main steps: Transcription (DNA  RNA) Translation (RNA  Protein)

6 Key Point #1- DNA must be transcribed into RNA inside the nucleus.
DNA does not leave the nucleus, so in order to make proteins, RNA must be made. RNA = ribonucleic acid We call this process Transcription because the DNA code is being transcribed into RNA. Imagine you are an architect of a very special building, would you let your only set of blue prints leave with the builder?

7 Key Point #2- DNA and RNA contain the same genetic code.

8 Nucleic Acids DNA serves as a templet to make RNA
Deoxyribose sugar Nucleotides: A, C, T, G Shape: double- stranded One type RNA Ribose sugar Nucleotides: A, C, U, G Shape: single- stranded Three types: rRNA, mRNA, tRNA

9 Transcription: How does Transcription work
DNA strand is the template for RNA match RNA bases CG G C T A A U (instead of T) RNA polymerase = Enzyme unzips and reads DNA Similar to what process? DNA replication Except we are only making 1 strand and replacing the T with U

10 Transcription Step 1 RNA polymerase unzips double stranded DNA A G T C

11 Transcription Step 2 Match RNA bases to DNA bases on one of the DNA strands Uracil (instead of Thymine) is matched to A TACGCACATTTACGTACGCGG U DNA A G C RNA polymerase U AUGCGUGUAAAUGCAUGCGCC mRNA A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

12 I wish I was adenine, then I could get paired with U..
* Hint: remember… RN*A* loves “U” I wish I was adenine, then I could get paired with U..  RNA uses Uracil instead of Thymine

13 Steps of Transcription
Newly built mRNA exit the nucleus and heads to the ribosomes in the cytoplasm

14 Lets Practice DNA STRAND: GAATTACA CUUAAUGU CCAATTAG GGUUAAUC ATAGACAG
UAUCUGUC CCAGTACA GGUCAUGU

15 Practice with Transcription: Complete on LEFT
Let’s practice transcription! I’ll give you one strand of DNA, and you complete the complementary strand of RNA. (Remember, in RNA replace A with U). DNA strand: ATT AGG CCG GAT TAG CCT ATT RNA strand: UAA UCC G k DNA strand: ATT GCA TTA TCG ATT ATC CTA RNA strand: l

16 Practice with Transcription
Let’s practice transcription! I’ll give you one strand of DNA, and you complete the complementary strand of RNA. (Remember, in RNA replace A with U). DNA strand: ATT AGG CCG GAT TAG CCT ATT RNA strand:UAA UCC GGC CUA AUC GGA UAA DNA strand: ATT GCA TTA TCG ATT ATC CTA RNA strand: UAA CGU AAU AGC UAA UAG GAU

17 Create the following table onto LEFT page
DNA BOTH RNA

18 Compare and Contrast DNA and RNA
contains genetic information uses the sugar deoxyribose double stranded used in transcription single stranded Can leave the nucleus A=U A=T cannot leave the nucleus used in DNA Replication made up of phosphates, sugars and nitrogen bases uses the sugar ribose use G, C and A Sort the following bullets into the category it should go into the chart you just made.

19 DNA Both RNA double stranded single stranded A=T
uses the sugar deoxyribose cannot leave the nucleus used in DNA Replication -both are used in transcription -made up of phosphates, sugars and nitrogen bases -contain genetic information -use G, C and A single stranded A=U uses the sugar ribose Can leave the nucleus used in translation

20 Independent Practice: meaning on your own!
Complete Individual Transcription Practice… both sides. This will go onto the LEFT side of your Interactive Notebook C- level 2 voice H- ask 3 before me A- transcription worksheet M- remain seated at your assigned table (moving around will be a strike!) P- complete your own practice sheet and paste in your notebook Success!


Download ppt "Protein Synthesis: Transcription"

Similar presentations


Ads by Google