1. Protein Synthesis Activity
Read through the procedures. What is occurring at each step?
Nucleus (back table)
Copy the DNA template A onto your lab sheet THEN Transcribe the DNA template onto your lab sheet
Ribosome (original table)
Other team members copy the DNA and mRNA (check for accuracy)
mRNA/Codon
Send one person to locate the correct codon and write the WORD on the back of the card onto your lab sheet.
Return to your group and report your findings
Protein Sentence
Get your sentence checked- it should start with ‘start’ and end with ‘stop’
Genetic Code
Use the genetic code to translate your mRNA to the appropriate amino acid

2. Protein Synthesis Activity
What are you doing in the nucleus?
How many people from each group?
Where are the ribosomes? What do you do there?
How will you know you are doing it right?
How do you find your Amino Acid chain?
How long will you have?

3. Protein Synthesis Lab C- level 2 voice H- ask three before me
A- In groups of 3, complete the process of protein synthesis moving from nucleus to ribosome.
M- remain at your ribosome (table) unless you are the mRNA transcribing the DNA
P- complete 3 complete protein synthesis sentences on your lab sheet
Success

4. Protein Synthesis Lab Honors
C- level 2 voice
H- ask three before me
A- In groups of three, complete the process of protein synthesis moving from nucleus to ribosome (mRNA to tRNA to Protein)
M- remain at your ribosome (table) unless you are the mRNA transcribing the DNA or the tRNA anticodon
P- complete 3 complete protein synthesis sentences on your lab sheet
Success

5. Genes Genes in our DNA code for proteins Proteins create traits
Transcription & Translation
Proteins create traits
DNA
TACGCACATTTACGTACGCGG
mRNA
AUGCGUGUAAAUGCAUGCGCC aa
protein
trait

6. What if something goes wrong??

7. Mutations Mutations are changes in DNA sequences
changes to the order of nucleotides (A, T, C & G)
different order = different amino acid in protein
different protein structure = different protein function

8. What Causes Mutations? Mutations can be inherited.
There are two ways in which DNA can become mutated:
Mutations can be inherited.
Parent to child
Mutation in the gametes (sperm or egg)
Mutations can be acquired.
Mutagens = agents in the environment that can change DNA (UV light, radiation such as X-rays, chemicals in food, water, air, buildings, etc).
Mistakes when DNA is copied
Mistakes during crossing over

9. Types of Mutations: Gene Mutation
Changes in DNA that affect genetic information
Typically occur during replication
May or may not show in phenotype
Phenotype – the physical characteristics of an organisms
Ex: Skin color, eye color, height,
Frameshift mutation: the insertion or deletion of a nucleotide in the DNA sequence
Point mutation: one nucleotide is substituted for another

10. Gene Mutation

11. Types of Mutations: Chromosomes
Change to a group of genes or entire chromosome
Typically happens during meiosis
Gene duplication: caused by the exchange of unequal segments during crossing over.
1 chromosome can have 2 copies of some genes and the other chromosome has no copies of those genes
Translocation: movement of a piece of one chromosome to a non- homologous chromosome

12. Potential Impact to Phenotype
Some mutations are harmful
Reduce the organisms chances of survival
Some mutations are beneficial
Improve the organisms chance of survival
Lead to genetic variation
Most mutations are neutral (Silent)
No advantage or disadvantage to an organism
Silent mutations- have no apparent effect on phenotype (physical traits)
Gene mutations can be silent but not chromosome mutations

13. Potential Impact to Offspring
What is the impact of a mutation in a somatic cell?
Only impacts the organism in which they occur
Are not passed to offspring
What is the impact of a mutation in a gamete?
Mutation can be passed to offspring
Source of genetic variation

14. How are mutations related to protein synthesis?
Changes in the DNA can cause a change in the protein

15. Bring it all together: Protein Synthesis
Protein synthesis involves transcription and translation
Step 1: Transcription (DNA to RNA)
In the nucleus
Nucleotides: A, U, C, G
Step 2: Translation (RNA to protein)
On the ribosomes
Reads mRNA Codons
How many nucleotides code for an amino acid?
3nucleotides = 1 codon = 1 amino acid
More than 1 codon can code for the same amino acid
mRNA codon pairs with tRNA anticodon to code for protein

16. 1. A codon chart is shown to the right.
Which of these changes to the DNA triplet 3’ GCT 5’ will affect the protein produced?
GTT
TCC
TCT
GCA

17. Quiz next class on PS- study guide on the website!
Exit ticket!!
Quiz next class on PS- study guide on the website!

18. 1. The table shows a DNA sequence and three types of mutations that can change the DNA sequence.
Which mutation will cause translation to stop?
Mutations 1 and 3 only
Mutation 1 only
Mutation 2 only
Mutations 1, 2, and 3

19. 2. The sequence of DNA below is part of a gene
2. The sequence of DNA below is part of a gene. How many amino acids are coded for by this segment?
5' ATCAGCGCTGGC 3' 4 8 12 24

20. 3. A DNA strand with the sequence AACGTAACG is transcribed
3. A DNA strand with the sequence AACGTAACG is transcribed. What is the sequence of the mRNA molecule synthesized?
A) AACGTAACG
B) UUGCAUUGC
C) AACGUAACG
D) TTGCATTGC

21. RNA contains which bases?
A) adenine, thymine, guanine, cytosine, uracil
B) adenine, thymine, guanine, cytosine
C) thymine, guanine, cytosine, uracil
D) adenine, guanine, cytosine, uracil