1. How to catch criminals through their relatives (distant)
Daniel Kling, Forsker
OUS – Avdeling for Rettsgenetikk

2. Why is this interesting?

3. Genetics – what do we need to know?

4. Brief biology DNA - Code Chromosomes Genetic markers
Variants (alleles)

5. From sample to genetic code
Sequencing
Microarray (chip)
- Expensive ($1000-$2000) - Bioinformatics! + Minute amounts of DNA
+ Cheap (probably <$50) + Used by 23andMe, Ancestry.com - «Hugh» amount of DNA

6. How do we determine relationships?

7. Paternity F M F M C C A/A G/G A/G
Probability of paternity is proportional to the rarity of the shared variant (allele)

8. Beyond paternity - your relatives
You share only about 0.8% of your DNA with your Third cousins (3C)

9. Forensic Genealogy

10. What is a direct-to-consumer test?
Order test
Spit in a cup
Results

11. Popularity of genealogy companies

12. Going further – What can you do more?
Rawdata
Accepts only data from these companies
GEDmatch
Anonymous
No genetic testing
Compare
«Free»

13. Golden State killer >50 rapes, >12 murders, >100 burglaries
>50 rapes, >12 murders, >100 burglaries

14. Golden State killer How did they find the perpetrator?
1. Identify traces
2. Genome analysis
AGCTTGCTAGCTGATCGATGCTAGCTA…
GATCGATGCTGATCGGATAATGCTGAT…
AGCTTGCTAGCTGATCGATGCTAGCTA…
GATCGATGCTGATCGGATAATGCTGAT…
3. Fake DNA profile
4. Search GEDmatch
5. Genealogical records
6. Investigations

15. 1st cousins 2nd cousins 3rd cousins Perpetrator one of them!
Who are her 3rd cousins?

16. Golden State killer
One (or more) of his 3rd cousins had their profiles in GEDmatch!

17. Size matters
”If 2% of the population is in the database – you can be found!”

18. Future Missing persons Cold cases

19. Future

20. Presentation
Epost:

21. How to catch criminals through the use of their relatives (distant)
Daniel Kling, Forsker
OUS – Avdeling for Rettsgenetikk