1. Introduction to Python
BCHB524 Lecture 5
BCHB524 - Edwards

2. Outline Homework #2 Solutions Homework #1 Notes DNA as a string
Extracting codons in DNA
Counting in-frame codons in DNA
Reverse Complement
Program Input/Output
raw_input, command-line arguments
standard-input, standard-output, redirection
BCHB524 - Edwards

3. Homework #1 Notes Python programs: Writeup: Upload .py files
Don't paste into comment box
Don't paste into your writeup
Writeup:
Upload .txt files,
Text document preferred
BCHB524 - Edwards

4. Homework #1 Notes Multiple submissions: Grading: OK, but…
…I'll ignore all except the last one
Make each (re-)submission complete
Grading:
Random grading order
Comments
Grading "curve"
BCHB524 - Edwards

5. Review Printing and execution Variables and basic data-types:
integers, floats, strings
Arithmetic with, conversion between
String characters and chunks, string methods
Functions, using/calling and defining:
Use in any expression
Parameters as input, return for output
Control Flow:
if statements – conditional execution
for statements – iterative execution
BCHB524 - Edwards

6. DNA as a string
seq = "gcatgacgttattacgactctgtgtggcgtctgctgggg" seqlen = len(seq) # set i to 0, 3, 6, 9, ..., 36 for i in range(0,seqlen,3):     # extract the codon as a string     codon = seq[i:i+3]          print codon print "Number of Met. amino-acids", seq.count("atg")
BCHB524 - Edwards

7. DNA as a string What about upper and lower case?
ATG vs atg?
Differences between DNA and RNA sequence?
Substitute U for each T?
How about ambiguous nucleotide symbols?
What should we do with ‘N’ and other ambiguity codes (R, Y, W, S, M, K, H, B, V, D)?
Strings don’t know any biology!
BCHB524 - Edwards

8. DNA as a string
seq = "gcatgacgttattacgactctgtgtggcgtctgctgggg" def inFrameMet(seq):     seqlen = len(seq)     count = 0     for i in range(0,seqlen,3):         codon = seq[i:i+3]         if codon.upper() == "ATG":             count = count + 1     return count print "Number of Met. amino-acids", inFrameMet(seq)
BCHB524 - Edwards

9. DNA as a string
input_seq = "catgacgttattacgactctgtgtggcgtctgctgggg" def complement(nuc):     nucleotides = 'ACGT'     complements = 'TGCA'     i = nucleotides.find(nuc)     comp = complements[i]     return comp def reverseComplement(seq):     newseq = ""     for nuc in seq:         newseq = complement(nuc) + newseq     return newseq print "Reverse complement:", reverseComplement(input_seq)
BCHB524 - Edwards

10. DNA as a string
input_seq = "catgacgttattacgactctgtgtggcgtctgctgggg" def complement(nuc):     nucleotides = 'ACGT'     complements = 'TGCA'     i = nucleotides.find(nuc)     if i >= 0:         comp = complements[i]     else:         comp = nuc     return comp def reverseComplement(seq):     seq = seq.upper()     newseq = ""     for nuc in seq:         newseq = complement(nuc) + newseq     return newseq print "Reverse complement:", reverseComplement(input_seq)
BCHB524 - Edwards

11. Creating reusable programs
Need to get input data and options from the user
…often us, but sometimes others, or us later.
Sometimes, want completely new inputs
…but often, want the same or similar input.
Sometimes, typing the input is OK
…but often, want to use data in a file.
Sometimes, output to the screen is OK
…but often, want the result to go into a file.
BCHB524 - Edwards

12. Interactive input
input_seq = raw_input("Type your codon: ") def complement(nuc):     nucleotides = 'ACGT'     complements = 'TGCA'     i = nucleotides.find(nuc)     if i >= 0:         comp = complements[i]     else:         comp = nuc     return comp def reverseComplement(seq):     seq = seq.upper()     newseq = ""     for nuc in seq:         newseq = complement(nuc) + newseq     return newseq print "Reverse complement:", reverseComplement(input_seq)
BCHB524 - Edwards

13. Command-line input
import sys input_seq = sys.argv[1] def complement(nuc):     nucleotides = 'ACGT'     complements = 'TGCA'     i = nucleotides.find(nuc)     if i >= 0:         comp = complements[i]     else:         comp = nuc     return comp def reverseComplement(seq):     seq = seq.upper()     newseq = ""     for nuc in seq:         newseq = complement(nuc) + newseq     return newseq print "Reverse complement:", reverseComplement(input_seq)
BCHB524 - Edwards

14. Interactive and file input
import sys input_seq = sys.stdin.read()
def complement(nuc):     nucleotides = 'ACGT'     complements = 'TGCA'     i = nucleotides.find(nuc)     if i >= 0:         comp = complements[i]     else:         comp = nuc     return comp def reverseComplement(seq):     seq = seq.upper()     newseq = ""     for nuc in seq:         newseq = complement(nuc) + newseq     return newseq print "Reverse complement:", reverseComplement(input_seq)
BCHB524 - Edwards

15. File input only
import sys seq_file = sys.argv[1] # MAGIC: open file, read contents, and remove whitespace input_seq = ''.join(open(seq_file).read().split()) def complement(nuc):     nucleotides = 'ACGT'     complements = 'TGCA'     i = nucleotides.find(nuc)     if i >= 0:         comp = complements[i]     else:         comp = nuc     return comp def reverseComplement(seq):     seq = seq.upper()     newseq = ""     for nuc in seq:         newseq = complement(nuc) + newseq     return newseq print "Reverse complement:", reverseComplement(input_seq)
BCHB524 - Edwards

16. Input Summary
raw_input provides interactive values from the user (also copy-and-paste)
sys.stdin.read() provides interactive or file-based values from the user (also copy-and-paste)
sys.argv[1] provides command-line values from the user (also copy-and-paste)
value can be a filename that provides user-input
Terminal standard-input redirection "<" can be used to send a file's contents to raw_input or sys.stdin.read()
BCHB524 - Edwards

17. Output is easy… Just use print, right?
Print statements go to the terminal's standard-output.
We can redirect to a file using ">"
Errors still get printed to the terminal.
We can also link programs together – standard-output to standard-input using "|"
Also, cat just writes its file to standard out
BCHB524 - Edwards

18. Connect reverse complement w/ codon counting…
Create and test rc.py from earlier slides:
Sequence from standard-input
Reverse complement sequence to standard-output
Create and test codons.py from earlier slides:
Count to standard-output
Place example sequence in file: test.seq
Execute: cat test.seq | python rc.py | python codons.py
BCHB524 - Edwards

19. In general Windows and OS X have similar facilities
cmd in windows, terminal in OS X
Powerful mechanism for making reusable programs
No knowledge of python required for use!
Most bioinformatics software is used from the command-line w/ command-line arguments:
Files provide sequence data, etc.
I'll promote this style of program I/O.
BCHB524 - Edwards

20. Exercise 1
Use NCBI Probe (“google NCBI Probe”) to look up PCR markers for your favorite gene
Write a command-line program to compute the reverse complement sequence for the forward and reverse primer.
BCHB524 - Edwards

21. Exercise 2
Write a command-line program to test whether a PCR primer is a reverse complement palindrome.
Such a primer might fold and self-hybridize!
Test your program on at least the following primers:
TTGAGTAGACGCGTCTACTCAA
TTGAGTAGACGTCGTCTACTCAA
ATATATATATATATAT
ATCTATATATATGTAT
BCHB524 - Edwards