1. Unlocking the mystery of DNA
Liz LaRosa

2. Prior to the 1950’s
What we knew:
Inherited characteristics are determined by genes
Genes are passes from one generation to the next
Genes are part of a chromosome
Chromosomes are made of protein and DNA

3. Cell division and DNA replication
Cells divide
Growth, Repair, Replacement
Before cells divide, they have to double cell
structures, organelles and their genetic
information

4. DNA replication – Mitosis & Meiosis

5. But…
What did DNA
look like, and how did it replicate itself?

6. Discovering the structure of DNA
Rosalind Franklin ( )
King’s College, London
Made significant advances in
x- ray diffraction techniques
with DNA
Her images suggested that
DNA had a spiral shape
One of her DNA images

7. Discovering the structure of DNA
Maurice Wilkins – ( )
King’s College, London
Also did X-ray diffraction studies
of DNA
Worked with Rosalind Franklin
Shared information with Watson and Crick

8. Discovering the structure of DNA
Erwin Chargaff – ( )
Columbia University, NY
Investigated the composition of DNA
His findings by 1950 strongly
suggested the base-pairings
of A-T & G-C
Met with Watson and Crick in
1952 and shared his findings
“Chargaff’s rule” A = T & C = G

9. Discovering the structure of DNA
James Watson (1928) and Francis Crick ( )
Worked together at Cavendish Laboratory in Cambridge
to determine the structure of DNA
Used work from Franklin, Wilkins, and Chargaff to
determine the double helix shape
Watson, Crick, and Wilkins
were awarded the Nobel Prize
Rosalind Franklin passed away
(1958) before the Nobel Prize
was awarded in 1962

10. Discovering the structure of DNA
DNA = Deoxyribose nucleic acid
Present in all living cells
Contains all the information
Nucleotides:
a subunit that consists of:
a sugar (deoxyribose)
a phosphate
and one nitrogen base – 4 different bases
Adenine (A) and Thymine (T)
Guanine (G) and Cytosine (C)

11. DNA – What does my code look like?
Computer Code:
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…
“Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

12. G A T T A C A C T A A T G T Practice DNA Base Pairs
“Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

13. DNA replication – helix unzips

14. DNA replication – helix unzips

15. DNA replication – two strands are separated

16. DNA replication – each side is now a template

17. DNA replication – two identical strands of DNA
Original DNA strands

18. DNA replication
Newly assembled DNA strands

19. DNA replication
Semi-conservative replication

20. Build a DNA molecule – you try it!

21. DNA replication- you try it!