1. Prokaryotic Transcription
Nilansu Das
Dept. of Microbiology
Surendranath College

2. Group A: Cellular and Molecular Biology
Paper III
Group A: Cellular and Molecular Biology
Unit I
1. DNA Replication: (10)
DNA-Replication-Meselson-Stahl experiment as evidence for semiconservative
replication; Mechanism of replication-Rolling-circle model & Theta (8) structure
(bidirectional)
2. Transcription in prokaryotes: (15)
Mechanisms (Initiation, elongation, termination); promoter structures, subunits of bacterial polymerases, functions and domains responsible for activity, elongationprocess, mechanism of termination, -dependent and independent termination; lac, trp, ara operons.
3. Mechanism of translation in prokaryotes: (15)
Description of ribosomal cycle including phenomena of initiation, elongation, termination; description of factors involved in these processes; genetic code; tRNA: clover-leaf structure & function; rRNA: structure and function; role of aminoacyl tRNA synthetases.
Non-ribosomal peptide synthesis: cyclic peptide antibiotics e.g. Gramicidin etc.

3. Basic facts
Transcription is the first stage in gene expression and the principal step at which it is controlled.
Transcription itself is an autonomous activity of an enzyme, RNA Polymerase, which attaches to DNA at the start of a gene and then moves along, transcribing RNA.
Genes are however not transcribed indiscriminately. Regulatory proteins determine whether a particular gene will be transcribed or not.

4. Transcription can be divided into 3 stages
1. INITIATION
2. ELONGATION
3. TERMINATION
Initiation begins with the binding of RNA polymerase to the ds DNA.
RNA synthesis starts denovo after local unwinding of the template DNA
The initiation stage may be protracted by the occurrence of abortive initiation, when the enz makes short (2-9 bases) transcripts and aborts them.

5. Initiation continued...
The sequence in DNA required for initiation reaction is called promoter.
The site at which the first nucleotide is incorpoated is called the startsite or startpoint
The enzyme (RNAP) does not move during the initiation phase; it only shrinks from behind.

6. Tanscription in Prokaryotes
Polymerization catalyzed by RNA polymerase
Can initiate synthesis
Uses rNTPs
Requires a template
Unwinds DNA
4 stages
Recognition and binding
Initiation
Elongation
Termination and release
Polymerization catalyzed by RNA polymerase
Can initiate synthesis
Uses rNTPs
Requires a template
Template recognition
RNA pol binds to DNA
DNA unwound
4 STAGES
Initiation—Chains of 2-9 bases are synthesized and released
Elongation
RNA pol moves and synthesizes RNA
Unwound region moves
Termination
RNA pol reaches end
RNA pool and RNA released
DNA duplex reforms

7. Tanscription in Prokaryotes
4 stages of Transcription
Recognition and binding
Initiation
Elongation
Termination and release
Polymerization catalyzed by RNA polymerase
Can initiate synthesis
Uses rNTPs
Requires a template
Template recognition
RNA pol binds to DNA
DNA unwound
4 STAGES
Initiation—Chains of 2-9 bases are synthesized and released
Elongation
RNA pol moves and synthesizes RNA
Unwound region moves
Termination
RNA pol reaches end
RNA pool and RNA released
DNA duplex reforms

8. Stages of Transcription
Template recognition
RNA pol binds to DNA
DNA unwound
Initiation
Elongation
RNA pol moves and synthesizes RNA
Unwound region moves
Termination
RNA pol reaches end
RNA pol and RNA released
DNA duplex reforms
Template recognition
RNA pol binds to DNA
DNA unwound
Initiation—Chains of 2-9 bases are synthesized and released
Elongation
RNA pol moves and synthesizes RNA
Unwound region moves
Termination
RNA pol reaches end
RNA pool and RNA released
DNA duplex reforms

9. RNA Polymerase 5 subunits, 449 kd (~1/2 size of DNA pol III)
Core enzyme
2  subunits---hold enzyme together
--- links nucleotides together
’---binds templates
---recognition of promoter
Holoenzyme= Core + sigma
5 subunits, 449 kd (~1/2 size of DNA pol III)
Core enzyme
2  subunits---hold enzyme together
--- links nucleotides together
’---binds templates
---recognition
Holoenzyme= Core + sigma

10. RNA Polymerase Features
Starts at a promoter sequence, ends at termination signal
Proceeds in 5’ to 3’ direction
Forms a temporary DNA:RNA hybrid
Has complete processivity
Starts at a promoter sequence, ends at termination signal
Proceeds in 5’ to 3’ direction
Forms a temporary DNA:RNA hybrid
Has complete processivity

11. RNA Polymerase X-ray studies reveal a “hand” Core enzyme closed
Holoenzyme open
Suggested mechanism
NOTE: when sigma unattached, hand is closed
RNA polymerase stays on DNA until termination.
X-ray studies reveal a “hand”
Core enzyme closed
Holoenzyme open
Suggested mechanism
NOTE: when sigma leaves, hand is closed
RNA polymerase stays on DNA until termination.

12. A Simple Prokaryotic Gene

13. Recognition Template strand Coding strand Promoters
Binding sites for RNA pol on template strand
~40 bp of specific sequences with a specific order and distance between them.
Core promoter elements for E. coli
-10 box (Pribnow box)
-35 box
Numbers refer to distance from transcription start site
Template strand-complementary to transcript
Coding strand-DNA version of transcript
Promoters
Binding sites for RNA pol on template strand
~40 bp of specific sequences with a specific order and distance between them.
Core promoter elements for E. coli
-10 box (Pribnow box)
-35 box
Numbers refer to distance from transcription start site
NOTE The two strands can contain different genes or sets of genes but only one serves as the template strand at a time.

14. Template and Coding Strands
Sense (+) strand
DNA coding strand
Non-template strand
DNA template strand
antisense (-) strand
5’–TCAGCTCGCTGCTAATGGCC–3’
3’–AGTCGAGCGACGATTACCGG–5’
transcription
NOTE Both strands can contain info for transcription
5’–UCAGCUCGCUGCUAAUGGCC–3’
RNA transcript

15. The Promoter -35 hexamer Pribnow box
5-9 bps
16-19 bps
TTGACA
TATAAT
-35 hexamer
Pribnow box
A typical promoter has 3 components :
consensus sequence at -35
consensus sequence at -10
startpoint

16. E.coli sigma factors recognize promoters with different consensus sequences
Gene
Mass
Use
-35 seq
Separation
-10 seq
rpoD
70K
general
TTGACA
16-18 bp
TATAAT
rpoH
32K
Heat shock
CNCTTGAA
13-15 bp
CCCCATNT
rpoN
54K
nitrogen
CTGGNA
6 bp
TTGCA
flaI (?)
28K
flagellar
TAAA
15 bp
GCCGATAA

17. Typical Prokaryote Promoter
Consensus sequences
Pribnow box located at –10 (6-7bp)
-35 sequence ~(6bp)
Consensus sequences: Strongest promoters match consensus
Up mutation: mutation that makes promoter more like consensus
Down Mutation: virtually any mutation that alters a match with the consensus
Pribnow box located at –10 (6-7bp)
-35 sequence ~(6bp)
Consensus sequences: Strongest promoters match consensus
Up mutation: mutation that makes promoter more like consensus
Down Mutation: virtually any mutation that alters a match with the consensus

19. In Addition to Core Promoter Elements
UP (upstream promoter) elements
Ex. E. coli rRNA genes
Gene activator proteins
Facilitate recognition of weak promoter
E. coli can regulate gene expression in many ways
UP (upstream promoter) elements—Found in some very strong promoters.
Ex. E. coli, in rRNA genes, see near consensus -35 box, perfect -10 box, but between 40-60nt upstream, see a sequence that stimulates transcription 30X
Gene activator proteins
Facilitate recognition of weak promoter

21. Transcription Initiation
Steps
Formation of closed promoter (binary) complex
Formation of open promoter complex
Ternary complex (RNA, DNA, and enzyme), abortive initiation
Promoter clearance (elongation ternary complex)
First rnt becomes unpaired
Polymerase loses sigma
NusA binds
Ribonucleotides added to 3’ end
Formation of closed promoter (binary) complex
Formation of open promoter complex—Pol unwinds small region from +3 to -10 nt. Region generally high in A-T.
Once open complex is formed, RNA pol ready to initiate synthesis. NOTE: RNA pol contains two binding sites, initiation and elongation. Initiation pocket favors purines, usually first rNTP brought in (first base in DNA is T or C). Elongation site is then filled with the next rNTP. RNA pol moves along, maintaining stretch of ~13 bases.
Ternary complex (RNA, DNA, and enzyme), abortive initiation. RNA pol stalls, makes several small transcripts tha fall off. Eventually extends chain, escapes promoter.
Promoter clearance
First rnt becomes unpaired
Polymerase loses sigma
NusA binds—NusA is a protein that assists in elongation
RNA polymerase holoenzyme scans DNA and pauses at promoter region. DNA is double helical (closed complex)
RNA polymerase unwinds a bp DNA region (open complex). This creates (+) supercoiling downstream and (-) supercoiling upstream of the RNA polymerase.
Initial 8 – 9 nucleotides are polymerized before the sigma factor is released.
The first base is either pppA or pppG.

22. Initiation of Transcription

23. Closed (Promoter) Binary Complex Open binary complex
Holoenzyme
Core + 
Closed (Promoter) Binary Complex
Open binary complex
Ternary complex
Promoter clearance

24. Sigma () Factor Essential for recognition of promoter
Stimulates transcription
Combines with holoenzyme
“open hand” conformation
Positions enzyme over promoter
Does NOT stimulate elongation
Falls off after 4-9 nt incorporated
“Hand” closes
Essential for recognition of promoter
RNAP only binds to specific sequences (promoters) with tight affinity when the sigma factor joins it to form the RNAP holoenzyme
Stimulates transcription
Combines with holoenzyme
“open hand” conformation
Positions enzyme over promoter
Does NOT stimulate elongation
Falls off after 4-9 nt incorporated. Can then nbind to other RNA pol.
“Hand” closes

25. Variation in Sigma
Variation in promoter sequence affects strength of promoter
Sigmas also show variability
Much less conserved than other RNA pol subunits
Several variants within a single cell. EX:
E. coli has 7 sigmas
B. subtilis has 10 sigmas
Different  respond to different promoters
Variation in promoter sequence affects strength of promoter
Sigmas also show variability
Much less conserved than other RNA pol subunits
Several variants within a single cell. EX:
E. coli has 7 sigmas
B. subtilis has 10 sigmas
Different  respond to different promoters
The presence of alternate sigma factors provides the cell with a mechanism for turning on and off entire families of genes under different circumstances

26. Sigma Variability in E. coli
Sigma70 (-35)TTGACA (-10)TATAAT
Primary sigma factor, or housekeeping sigma factor.
Sigma54 (-35)CTGGCAC (-10)TTGCA
alternative sigma factor involved in transcribing nitrogen-regulated genes (among others).
Sigma32 (-35)TNNCNCNCTTGAA (-10)CCCATNT
heat shock factor involved in activation of genes after heat shock.
POINT: gives E. coli flexibility in responding to different conditions
Sigma70
Primary sigma factor, or housekeeping sigma factor.
One we have discussed in most detail.
Encoded by rpoD .
When bound to RNAP Core allows recognition of -35 and -10 promoters.
No other factors required for RNAP binding and transcription initiation.
Sigma54
alternative sigma factor involved in transcribing nitrogen-regulated genes (among others).
Encoded by rpoN (ntrA ).
Discussed in more detail in Ronson et al paper.
When bound to RNAP Core allows recognition of different promoters.
Requires an additional activator to allow open complex formation for transcription.
Sigma32
heat shock factor involved in activation of genes after heat shock.
Encoded by rpoH (htpR ).
Turned on by heat shock (either at the transcription or protein level).
Activates multiple genes involved in the heat shock response.
SigmaS (sigma38)
stationary phase sigma factor.
Encoded by rpoS .
Turned on in stationary phase.
Activates genes involved in long term survival, eg. peroxidase.

27. Sigma and Phage SP01
Early promoter—recognized by bacterial sigma factor. Transcription includes product, gp28.
gp28 recognizes a phage promoter for expression of mid-stage genes, including
gp33/34, which recognizes promoters for late gene expression.
Early promoter—recognized by bacterial sigma factor. Transcription includes product, gp28.
gp28 recognizes a phage promoter for expression of mid-stage genes, including
gp33/34, which recognizes promoters for late gene expression.

28. Promoter Clearance and Elongation
Occurs after nt are added
First rnt becomes unpaired from antisense (template) strand.DNA strands re-anneal
Polymerase loses sigma, sigma recycled
Result “Closed hand” surrounds DNA
NusA binds to core polymerase
As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal.
RNA pol/NusA complex stays on until termination. Rate=20-50nt/second.
Occurs after nt are added
First rnt becomes unpaired from antisense (template) strand.DNA strands re-anneal
Polymerase loses sigma, sigma recycled
Result “Closed hand” surrounds DNA
NusA binds to core polymerase
As each nt added to 3’, another is melted from 5’, allowing DNA to re-anneal.
RNA pol/NusA complex stays on until termination. Rat=20-50nt/second.

29. Open complex
Abortive initiation
Elongation

30. Elongation Elongating complex
An elongating complex may face pausing depending on sequence and rNTP availability
A paused complex may or may not undergo backtracking

31. Restoration of superhelicity after transcription
Gyrase
Topo I
+ve supercoiled
-ve supercoiled
RNAP
RNA
Transcription may generate more tightly wound (positively supercoiled) DNA ahead of RNA polymerase, while the DNA behind becomes underwound (negatively supercoiled).

32. Termination Intrinsic (Rho-independent) Rho-dependent
The intrinsic terminator module consists of a stem-loop sequence followed by a run of Us in RNA
UUUUUUUU-3’ 5’

33. Intrinsic Terminators
DNA template contains inverted repeats (G-C rich)
Can form hairpins
6 to 8 A sequence on the DNA template that codes for U
Consequences of poly-U:poly-A stretch?
Coding strand

34. Intrinsic Termination
RNA pol passes over inverted repeats
Hairpins begin to form in the transcript
Poly-U:poly-A stretch melts
RNA pol and transcript fall off
UUUUU
Model for intrinsic termination (withdrawal)
rU:dA base pair are exceptionally weak (Tm=200C
Hair-pins: release RNA
(ds structure)
A string U’s: pause transcription

35. Rho () Dependent Terminators
rho factor is ATP dependent DNA-RNA helicase
catalyses unwinding of RNA: DNA hybrid
rho termination factor:
- rho factor is ATP dependent helicase
- catalyses unwinding of RNA: DNA hybride
- binds to C rich region of RNA transcript
- moves along RNA chain to transcription site (bubble)
- in the transcription site it catalyses separation of RNA and template DNA

36. Rho Dependent Termination
(17 bp)
Rho Dependent Termination
rho factor is ATP dependent helicase
catalyzes unwinding of RNA: DNA hybrid
50~90 nucleotides/sec
rho factor is ATP dependent helicase
catalyses unwinding of RNA: DNA hybrid
50~90 nucleotides/sec
Is Rho a termination factor?
Rho affects chain elongation, but not initiation.
Rho causes production of shorter transcripts.
Rho release transcripts from the DNA template.

37. Rho: Mechanism
Rho binds to transcript at  loading site (up stream of terminator)
Hairpin forms, pol stalls
Rho helicase releases transcript and causes termination
Rho-factor
hexameric protein
Trails RNA polymerase 5’-3’ and hydrolyzes ATP when ssRNA is present
Rho is activated by sequences in the nascent mRNA molecule that are rich in cytosine and poor in guanine. Attaches to the Transcript recognition sequence.
Moves along transcript.
Rho then displaces the RNA polymerase from the DNA template (RNA-DNA helicase)
As the RNApol transcribes the inverted repeats, the transcript forms a stem-loop structure that is stabilized by G-C complementarity. Meanwhile the U-tail is complementary to the stretch of A (weak interaction).
Structural stability of G-C hairpin and weak base pairing appear to be important factors in ensuring termination. No precise length beyond teermination signals.
Hairpin causes RNA pol to stall. May induce conformational change in RNA pol (mimics sigma?), allowing DNA to reanneal, thus displacing transcript.
Additionally, may be involvement of downstream sequences.
hexamer

38. Termination continued...
UUUUUUUU-3’
A-U is the weakest hybrid 5’
Stem-loop formation removes the nascent RNA from ss binding region on the surface of RNAP

39. Intrinsic Termination
UUUUUUUU-3’ 5’

40. Rho-dependent Termination
Rho-loading seq
Rho protein binds as hexamers to a site in RNA called Rho-loading site.
Rho then rapidly moves along the RNA towards RNAP
Rho is a RNA-DNA helicase

41. Rho-dependent Termination

42. Thank You