1. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
CACGTGGACTGAGGACACCTC

2. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
CACGTGGACTGAGGACACCTC
What does it matter???

3. CACGTGGACTGAGGACTCCTC Codon for CTC = glutamate
CACGTGGACTGAGGACACCTC
Codon for CAC =
valine
What does it matter???

4. Mutations

5. Any mistake or change in DNA sequence
Mutations
Any mistake or change in DNA sequence
What causes them?
Random or Environment influences – X-rays, UV rays, radioactive materials, chemicals, medications

6. Mutagens
 Radiation – UV, X-rays, nuclear

7. Mutagens
 Chemicals – asbestos, formaldehyde, chemicals in tobacco products
(many mutagens are also carcinogens – cancer causing)

9. be good, making an organism survive better in its environment
Example: bacteria becoming antibiotic-resistant
The ability to drink milk as an adult is a helpful mutation.

10. usually happens during DNA replication
in sex cells, it may affect individual’s offspring/children
in body cells, it may affect the individual

11. More about mutations Can be beneficial, harmless, or harmful
2 types: Gene & Chromosomal

12. Gene mutation:
Changes to the bases in the DNA of ONE gene
Chromosomal mutation: affects whole or part of a chromosome

13. 1. Gene Mutations Change in one or more nucleotides
Affects the amino acids and protein produced
2 types

14.  Point Mutation - a substitution of a single base pair
- changes only one amino acid (if any!)
Ex:
The dog bit the CAT
The dog bit the CAR

16. Sickle Cell Anemia

17. Some Point Mutations are Harmless
What amino acid is represented by the DNA sequence GGA?
What amino acid is represented by the DNA sequence GGC?
This change in the 3rd base of the codon is a point mutation, yet the amino acid would remain the same. Therefore, the protein would NOT be affected.

18. Some Point Mutations are Harmless
This type of point mutation is called a silent mutation.
Silent Mutations are possible due to the redundancy in the genetic code.

19.  Frameshift Mutation Single base pair is added or deleted from DNA
Causes a shift in the “reading frame”
Ex: Cystic Fibrosis
EX: cystic fibrosis

22. Nonsense Mutations
A point mutation or a shift in the reading frame can sometimes cause a premature STOP codon
This type of mutation is called a nonsense mutation
If the nonsense mutation occurs early in the mRNA sequence, the protein is greatly shortened and most likely non functional

23. Some mutations are beneficial
Gain-of-function mutations produce a functional protein that results in an entirely new trait
These mutations are usually beneficial and result in an advantage in an organism’s environment
EX: The mutation that resulted in eyesight

24. Practice – Name that Mutation1 2
Deletion ~ Frameshift
Silent ~ Point 4 3
Insertion, nonsense ~ Frameshift
Point 6 5
Deletion ~ Frameshift
Nonsense ~ Point

25. Types of Mutations
2. Chromosomal mutation – may affect more than one gene Examples: nondisjunction, deletion, insertion, inversion, translocation

26. What’s Happening in Japan