Presentation is loading. Please wait.

Presentation is loading. Please wait.

Simulation of Hybridization

Similar presentations


Presentation on theme: "Simulation of Hybridization"— Presentation transcript:

1 Simulation of Hybridization
Jang HaYoung

2 NACST/Sim Lab experiment simulation tool
Hybridization, PCR, gel electrophoresis Using thermodynamic data & artificial chemistry Hybridization simulator © 2003 SNU CSE Biointelligence Lab

3 © 2003 SNU CSE Biointelligence Lab
NACST/Sim Virtual Hybridization Essential to almost all the lab experiment. First step to simulation of lab experiment. © 2003 SNU CSE Biointelligence Lab

4 © 2003 SNU CSE Biointelligence Lab
NACST/Sim Nearest Neighbor method with 1-base mismatch © 2003 SNU CSE Biointelligence Lab

5 © 2003 SNU CSE Biointelligence Lab
NACST/Sim Nearest Neighbor method CGTACCTTAGGCT AGCTTAGGATGGCATGGAATCCGATGCATGGC © 2003 SNU CSE Biointelligence Lab

6 © 2003 SNU CSE Biointelligence Lab
NACST/Sim Difficulties © 2003 SNU CSE Biointelligence Lab

7 © 2003 SNU CSE Biointelligence Lab
NACST/Sim Difficulties Nearest Neighbor method? How can handle chain reaction? What is the reasonable size of the tube? How can detect the result? © 2003 SNU CSE Biointelligence Lab

8 © 2003 SNU CSE Biointelligence Lab
NACST/Sim Objective Parallelize? Refine the data structure Use sigmoid function as decision maker Handle the bulge and hairpin © 2003 SNU CSE Biointelligence Lab

9 DNA/RNA Secondary Structure
Thermodynamic method: Free Energy minimization– Zuker algorithm. Phylogenetic comparative method Grammar induction method Molecular Dynamics © 2003 SNU CSE Biointelligence Lab

10 DNA/RNA Secondary Structure
Grammar induction method Use stochastic context-free grammar Parse tree of the sequences represents the secondary sturcture A kind of thermodynamic method How can design the grammar? © 2003 SNU CSE Biointelligence Lab


Download ppt "Simulation of Hybridization"

Similar presentations


Ads by Google