1. Deoxyribonucleic Acid- DNA

2. DNA tells bodies how to grow.
                
DNA tells your body how fast your hair will grow.
DNA tells your body how big to make your feet.
DNA tells your body to put your skin on the outside.
DNA even tells your body to build your brain.

3. DNA: An Instruction Manual for Building a Body
Building a person involves following a set of instructions.
Your body stores those instructions in a long, twisted molecule, DNA.
It controls everything about the way you look, from the color of your eyes to how tall you are to the width of your feet.
You carry billions of copies of those DNA instructions.

4. DNA
The primary function of DNA is to store and transmit genetic information that tells cells which proteins to make and when to make them.

5. DNA Polymers are complex molecules composed of repeating subunits.
The repeating subunits in DNA and RNA are called nucleotides.

6. Watson and Crick
In 1953, James Watson and Francis Crick proposed a model for the DNA molecule that consisted of two nucleotide chains that wrap around each other to form a double spiral.
This shape is called a double helix.

7. Watson and Crick

8. Watson and Crick

9. Watson and Crick

10. Break Time
Asking for help is sometimes very hard, but people are always willing to help those in need.

11. Break Time
Asking for help is sometimes very hard, but people are always willing to help those in need.
Get help before it is to late!

13. DNA is a complex molecule found in all living things.

14. You think your nano is cool!

15. You think your nano is cool!

16. DNA

17. Each nucleotide is composed of:
1. A Sugar:
Deoxyribose - a 5-carbon sugar in DNA
Ribose - a 5-carbon sugar in RNA. This sugar has more oxygen than the sugar in DNA.

18. Each nucleotide is composed of:
2. One of these four nitrogen bases:
Purines - have a double ring of carbon and nitrogen atoms.
Adenine
Guanine
Pyrimidines - have a single ring of carbon and nitrogen atoms.
Thymine
Thymine is replaced by uracil in RNA.
Cytosine

19. Each nucleotide is composed of:
3. A phosphate group - PO4

20. What is it?
GGCACGAGGGTAAATATGGCATAAGTTAATAACA CTTTTCCCCAAAATGGTGCTTTGGATTTGAAAAGG GTCTGATGGGGAGAAGGAGAACGTATCATCCTAGC TTCCTCTCTTAATAAACCTAGAAAAACGGGTAGTA AACTGTGGATAGTCAGGAAAACACCCAGCAAGGGA CACAGC TGTCAGGAAATGAATCTTCCCCCCAACCC CCACCATGCAGATGGATAGACAGAATCTTTCCTGA CTAGTCATTAGGATCAGGGGCCTCTGTTGGATTTGT GTTTCTTGAAGAATAGCTGGCAGAGTGGTATAAAA GACACGAATATCTCCTGGTCTATAAGGATACTCTGA TTTGGGGTTTGCATTTTTCATGGTTTTTATTTCCTGT TCCCCCTGGAGTTTTCCATTAGTGAGTTTTTG

22. Break time
You must accept the truth even if it changes your point of view, or hurts.

23. Break time
Sometimes it just hurts!

25. Base-pairing rules
Base-pairing rules: these rules describe the behavior of the bases.

26. Base-pairing rules
Base-pairing rules: these rules describe the behavior of the bases.
Cytosine always bonds with guanine by forming three hydrogen bonds.

27. Base-pairing rules
Base-pairing rules: these rules describe the behavior of the bases.
Cytosine always bonds with guanine by forming three hydrogen bonds.
Adenine always bonds with thymine by forming two hydrogen bonds.
A pair of bases that always bond together is known as a complementary base pair.
Hydrogen bonds hold bases together

28. Enzymes and Catalyst
Catalyst-something that speeds up a chemical reaction.
Example- fire
Enzyme- A protein that acts as a catalyst within the body.
If a word ends with “ase”, its probably an enzyme.
Example- Amylase in saliva

29. Replication Replication-the process of duplicating the DNA molecule.
Why does DNA replicate?

30. Replication
The process in which DNA is copied by using each of the strands as a template for a new strand.
Because with each round of DNA synthesis the new DNA consists of one newly synthesized strand and one parental strand, the process of DNA replication is called semiconservative.

32. REPLICATION OF DNA
DNA replication begins with a partial unwinding of the double helix at an area known as the replication fork.
This unwinding is accomplished by an enzyme known as DNA helicase.
As the two DNA strands separate and the bases are exposed, the enzyme DNA polymerase moves into position at the point where synthesis will begin.

33. REPLICATION OF DNA
The DNA polymerase then adds nucleotides one by one in an exactly complementary manner, A to T and G to C.
Since each new strand is complementary to its old template strand, two identical new copies of the DNA double helix are produced during replication.