1. Copyright Pearson Prentice Hall
12–1 DNA
Photo credit: Jacob Halaska/Index Stock Imagery, Inc.
Copyright Pearson Prentice Hall

2. The Components and Structure of DNA
Review of Nucleic Acids
Function: Nucleic acids store and transmit genetic information.
Examples: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
DNA contains the sugar deoxyribose.
RNA contains the sugar ribose.
Building Blocks / Monomers: nucleotides.
Individual nucleotides can be joined by covalent bonds to form nucleic acids.
Copyright Pearson Prentice Hall

3. The Components and Structure of DNA
The Double Helix 
James Watson and Francis Crick discovered that DNA is in the shape of a double helix (like a twisted ladder).
Copyright Pearson Prentice Hall

4. The Components and Structure of DNA
There are four nitrogenous bases in DNA:
adenine
guanine
cytosine
thymine
DNA is made up of nucleotides. Each nucleotide has three parts: a deoxyribose molecule, a phosphate group, and a nitrogenous base. There are four different bases in DNA: adenine, guanine, cytosine, and thymine.
Copyright Pearson Prentice Hall

5. The Components and Structure of DNA
The backbone of a DNA chain is formed by the sugar and phosphate groups of each nucleotide.
The nucleotides can be joined together in any order to make a strand of DNA.
DNA is made up of nucleotides. Each nucleotide has three parts: a deoxyribose molecule, a phosphate group, and a nitrogenous base. There are four different bases in DNA: adenine, guanine, cytosine, and thymine.
Copyright Pearson Prentice Hall

6. The Components and Structure of DNA
Chargaff's Rules
Erwin Chargraff discovered that in any DNA molecule:
the amount of guanine [G] and cytosine [C] is almost the same, and
the amount of adenine [A] is almost the same as the amount of thymine [T].
Therefore, according to Chargraff’s Rules:
A = T and G = C
Copyright Pearson Prentice Hall

7. Copyright Pearson Prentice Hall
For example: ATTAGCTAGCTCATCGATCG pairs with TAATCGATCGAGTAGCTAGC
Copyright Pearson Prentice Hall

8. The Components and Structure of DNA
DNA Double Helix
DNA is a double helix in which two strands are wound around each other. Each strand is made up of a chain of nucleotides. The two strands are held together by hydrogen bonds between adenine and thymine and between guanine and cytosine.
Copyright Pearson Prentice Hall

9. Copyright Pearson Prentice Hall
Chromosome Structure Chromosomes – rod-shaped structure, usually found in pairs in a cell nucleus. A chromosome carries the genes, segments of DNA that have the directions (code) to make a protein, that determine gender and the characteristics an organism inherits from its parents.
Copyright Pearson Prentice Hall