1. Volume 7, Issue 3, Pages 571-579 (March 2001)
SOS Mutator DNA Polymerase IV Functions in Adaptive Mutation and Not Adaptive Amplification 
Gregory J McKenzie, Peter L Lee, Mary-Jane Lombardo, P.J Hastings, Susan M Rosenberg 
Molecular Cell 
Volume 7, Issue 3, Pages (March 2001)
DOI: /S (01)

2. Figure 1 DNA Polymerase IV Is Required for Most Lac+ Adaptive Mutation
(A) Total Lac+ colonies are shown as open symbols. Lac+ point mutants (see text) are plotted as filled symbols offset slightly from the day 5 point for clarity. The fraction of day 5 colonies carrying amplification (Experimental Procedures) was 9.5% (mean ± 2.6% SEM) in the dinB+ and 42% (± 5.6%) in the dinB10 strain.
(B) Decrease in mutation is complemented by a single, ectopic, chromosomal copy of dinB+ controlled by its natural promoter. dinB+ (open squares), dinB10 (open diamonds), dinB+ ΔattB::dinB+ (open circles), and (Δ) dinB10 ΔattB::dinB+(open triangles) strains SMR4562, SMR5830, SMR5834, and SMR5851, respectively. Means ± SEM (error bars) of ten independent cultures tested are shown (except for the filled symbols, mean ± SEM of four cultures). Where not visible, error bars are smaller than the plot symbol. Daily measurements of viable lac− cells on the plates (Relative cell number), shown normalized to the first day's count, show no net growth or death during the experiments (mean ± SEM, four cultures)
Molecular Cell 2001 7, DOI: ( /S (01) )

3. Figure 2
Different Roles of SOS Induction in Adaptive Amplification and Point Mutation
(A) Induction of the SOS/LexA regulon is not required for adaptive amplification. Total adaptive Lac+ colonies (open symbols) are decreased by the lexA3(Ind−) allele (open triangles), whereas the fraction amplified (filled symbols) is not. lexA+ (squares) and lexA3(Ind−) (triangles) strains SMR583 and SMR820, respectively.
(B) The contribution of SOS/LexA induction to adaptive point mutation is wholly via pol IV. Closed symbols display adaptive Lac+ point mutants for dinB+ lexA+ (squares), lexA3(Ind−) (triangles), dinB10 (diamonds), and dinB10 lexA3(Ind−) (circles) strains SMR583, SMR820, SMR5849, and SMR5850, respectively. This is the same experiment shown in (A) but with data from more of the strains tested in parallel shown, and point mutation displayed. Both sets of experiments were performed three times with similar results. In (B), the total adaptive Lac+ colonies are also shown for the dinB+ lexA+ control strain (open squares). Means ± SEM (error bars) of ten independent cultures tested are shown (except for the filled symbols, mean ± SEM of four cultures). Where not visible, error bars are smaller than the plot symbol. Daily measurements of viable lac− cells on the plates (Relative cell number), shown normalized to the first day's count, show no net growth or death during the experiments (mean ± SEM, four cultures)
Molecular Cell 2001 7, DOI: ( /S (01) )

4. Figure 3
Rates of Frameshift and Substitution Mutations in dinB+ and dinB10 Cells during Growth
The various frameshift and substitution mutation assays (see LaRossa, 1996) follow: Val, a variety of different mutations in the isoleucine/valine biosynthesis genes, conferring valine resistance; Strep and Spec, substitution mutations in two ribosomal protein genes conferring streptomycin and spectinomycin resistance, respectively; Nal, substitution mutations in the gyr genes conferring nalidixic acid resistance; and Tet, reversion of a +1 frameshift mutation (4G to 5G, Experimental Procedures) in a chromosomal tetA gene conferring tetracycline resistance. This is similar to the 3G to 4G lacI33 frameshift allele used in these adaptive mutation studies. dinB+ (filled bars) and dinB10 (hatched bars) strains are SMR4596 andSMR6049, respectively. Error bars, one SEM of three independent experiments
Molecular Cell 2001 7, DOI: ( /S (01) )

5. Figure 4
Loss of Pol IV Confers No Detectable Change in Survival of UV or Oxidative Damage
(A) UV sensitivity. Four cultures per strain were tested, and the means ± SEM (error bars) are shown. DinB+ (open squares), dinB10 (open diamonds), and lexA3(Ind−) (open circles), strains SMR4562, SMR5830, and FC231, respectively.
(B) Sensitivity to hydrogen peroxide. Four cultures of each strain were tested in parallel, and the mean ± SEM are shown. Strains are as in (A) with the addition of SMR5287 lacking exonuclease III (encoded by xthA), used in base excision repair of oxidatively damage DNA (reviewed by Friedberg et al., 1995). Both experiments were performed three times with similar results
Molecular Cell 2001 7, DOI: ( /S (01) )

6. Figure 5
DNA Pol IV Promotes –1 Deletions at a Variety of Mononucleotide Repeat Sites in Lac+ Adaptive Mutation
A roughly 300 nucleotide (nt) segment of DNA spanning the lac frameshift allele was sequenced from PCR-amplified DNA from day 5 dinB10 Lac+ point mutants (primers lacIL2 5′−AGGCTATTCTGGTGGCCGGA, and lacD2-GCCTCTTCGCTATTACGCCAGCT). Sequencing was performed by Lone Star Labs, Inc. (Houston, TX). Compensatory frameshift mutations in a possible 130 nt region between the two out-of-frame stop codons (boxed) can restore gene function. In dinB+ cells, adaptive reversions are –1 deletions at a hot spot (nt 1039) and at many different mononucleotide repeats sites highlighted above (nt 1059, 1064, 1071, 1075, and 1109, data from Rosenberg et al. 1994). In dinB10 cells, only the hot spot repeat is appreciably active for –1 repeat deletions, and other insertions and deletions are also prevalent. The other mutations include a –1 frameshift with an adjacent substitution (at nt 1094–5); a +2 insertion (nt 1092); an insertion of >40 bp (from 3′ of the sequenced area to nt 1120); and three large deletions of 103 bp (nt 1017–1119), 103 bp (979–1081), and 211 bp (nt 878–1088). Nt repeat positions are indicated above the leftmost base covered by the number, and the additional base of the original +1 frameshift mutation in the repeat at nt 1039 is not numbered
Molecular Cell 2001 7, DOI: ( /S (01) )

7. Figure 6
Overlapping Roles of Pol III and Pol IV in Adaptive Point Mutation
Open symbols are total Lac+ colonies, and filled symbols point mutants only for strains carrying dinB+ dnaE+ (squares), dinB10 (diamonds), dnaE915 (triangles), and dinB10 dnaE915 (circles): SMR6113, SMR5945, SMR6114, and SMR5944, respectively. The experiment was performed three times with similar results. Means ± SEM (error bars) of ten independent cultures tested are shown. Where not visible, error bars are smaller than the plot symbol. Daily measurements of viable lac− cells on the plates (Relative cell number), shown normalized to the first day's count, show no net growth or death during the experiments (mean ± SEM, four cultures)
Molecular Cell 2001 7, DOI: ( /S (01) )