1. LET THERE BE LIGHT: Quorum Sensing in Bacteria
Mary Shane
Alexandra Fairfield
Nick Galt
Davida Smyth
Vedham Karpakakunjaram
Carolyn Wetzel
Sarah Prescott
Monica GuhaMajumdar 1
of 10

2. Why did we choose Quorum Sensing?
Wanted a fun, interactive and visual way to teach a complicated system
Covers topics in the NGSS as well as Intro Biology to Microbiology, Genetics and more (we can dream!)
No known Cell Collective simulations or interactive modules for teaching quorum sensing 2
of 10

3. What concepts they will learn from this
Two-component signal transduction systems
Quorum sensing as a density-dependent phenomenon
Interaction between an inducer and a receptor
External factors affect quorum sensing (genetic regulation)
Positive feedback loop
Deleterious mutations and compensation in communities 3
of 10

4. Lesson Plan in Brief Before Class Watch videos, do readings
During Class
Reconstruct models
In class scenarios and simulations
Case studies
Analysis of mutations
After Class
Watch videos, do readings and reflect 4
of 10

5. The LuxR-LuxI Model Quorum Sensing – Answer Key glucose density CRP
Pheromone
LuxR
LuxI
LuxR-LuxR
LuxCDABE
Luciferase
Bioluminescence 5
of 10

6. Sample Case Study
After a long night of working in the lab, Student D was exhausted. Instead of putting the Vibrio culture in the 25°C incubator, they put the culture in the fridge
Run Simulation
Answer questions
a) Impact of temperature on bacterial growth
b) Impact of temperature on luminescence 6
of 10

7. 7
of 10

8. Wild-type LuxR gene Mutant LuxR gene
>NC_ LuxR
ATGAACATTAAAAATATAAATGCTAATGAGAAGATAATTGATAAAATTAAAACTTGTAATAATAATAAAGAT
>YP_ LuxR family transcriptional regulator
MNIKNINANEKIIDKIKTCNNNKD
Mutant LuxR gene
>LuxR mutant DNA sequence ATGAACATTAAAAATACAAATGCTAATGAGAAGATAATTGATAAAATTAAAACTTGTAATAATAATAAAGAT
>LuxR mutant protein sequence MNIKNTNANEKIIDKIKTCNNNKD
Students will have to translate & align the sequences => It’s a missense mutation! 8
of 10

9. Most importantly! Can they problem solve?
What could we assess?
Their model reconstruction
Their graphs derived from the simulation/data
If they can identify the mutations
Their reflections on the exercise
Most importantly! Can they problem solve? 9
of 10

10. Future Directions Complete this Project
Test in the Classroom in the next Academic Year
Share and collaborate
Improve (if needed)
Present the results in Virginia , NSTA and other places… 10
of 10