1. DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures
Casey Kernan
Mentor: Dr. Andrew Buermeyer
Department: Environmental & Molecular Toxicology
Oregon State University

2. Colorectal Cancer (CRC)
2nd leading cause of cancer deaths worldwide
CRC claims nearly 50,000 lives/year in U.S.
American Cancer Society estimates 147,000 new cases by 2011
Individuals deficient in MMR show elevated risk and susceptibility to acquiring mutations and often developing cancer, most notably colorectal cancer. Colorectal cancer is the second leading cause of cancer deaths in the United States. Statistics claim CRC takes nearly 50,000 lives per year with estimates of 147,000 new cases by 2011, further stressing the need to learn about the cellular pathways, proteins and risk factors associated with CRC. While about 80% of CRC cases are sporadic, the remaining 20% are hereditary.

3. Lynch Syndrome (HNPCC)
Autosomal dominant genetic condition
Mutation in one or more of the 4 MMR genes: MLH1 & PMS2 (MutLα) and MSH2 & MSH6 (MutSα)
MSH2
MSH6/ 3
PMS2
MLH1
Lynch Syndrome (or HNPCC) an autosomal dominant genetic condition is the most common hereditary CRC . Individuals having one or more close relatives with CRC have an increased risk from 2-fold to 6-fold. It is linked to a mutation in 4 MMR genes: MSH2, MLH1, PMS2 and MSH6, causing the cell to lack an efficient mismatch repair pathway. Tumors recognized in people with Lynch Syndrome display unique signature microsatellite instability. Microsatellites are repeated sequences of DNA. The length of these microsatellites is highly variable from person to person, however each individual has microsatellite sequences of set length. Familial members with mutations in DNA repair genes, accumulate errors in these microsatellite regions and become longer or shorter. Longer repetitive sequences are more susceptible to accumulating mutations. Individuals deficient in MMR are more susceptible to developing cancer comparatively to those with proficient MMR, especially when exposed to environmental carcinogenic compounds such as polycyclic Aromatic Hydrocarbons.

4. Mismatch Repair
A number of cellular pathways, processes and environmental genotoxins interact to influence an individual’s susceptibility and risk for developing cancer.
Apoptosis
A number of cellular pathways, processes and environmental genotoxins interact to influence an individual’s susceptibility and risk to developing cancer. Among these, a mechanism referred to as MMR plays an important role in preserving genomic stability, by identifying errors in DNA replication and correcting them either directly (excision and replacement) or indirectly by inducing apoptosis or cell cycle arrest. Individuals deficient in MMR show elevated risk and susceptibility to acquiring mutations and often developing cancer.

5. Recognition of Mismatch
ATP
ADP
MSH2
MSH6/ 3
MSH2
MSH6/ 3
PMS2
MLH1
DNA Mismatch Repair plays a key role in identifying errors in DNA replication. The most common error during DNA replication is the simple mispairing of nucleotide bases and is predicted to occur every one in basepairs. The DNA strand present contains a mispaired nucleotide base, Thymine. The MutSa complex composed of MSH2/MSH6 proteins is primarily responsible for recognizing base-base mismatches whereas the MutSb heterodimeric complex with MSH2 and MSH3 proteins recognizes and bind to DNA near large insertion deletion loops resulting from slippage occurring during the replication of repetitive sequences. Upon hydrolysis of ATP to ADP, the MutS complex undergoes a confirmation change to a sliding clamp which then translocates along the DNA backbone in search of the mismatch. MutS then recruits heterodimeric complex MutL composed of PMS2 and MLH1.
DNA replication error rate = 1 mispairing / basepairs
MutS heterodimer locates and binds mismatch
MutL heterodimer recruited and endonuclease activated

6. Excision of Mismatch hEXO1 hEXO1
MSH2
MSH6/ 3
PMS2
MLH1
RPA
hEXO1
hEXO1
The MutS sliding clamp initiates the activity of Exo1 (Exonuclease 1). Exonuclease1 situates itself at a nick 5’ from the mispair. As it travels towards the mismatch containing thymine, it degrades the stretch of nucleotides (usually several hundred). After degradation of the nascent strand, the remaining strand of DNA is stabilized by RPA (Replication Protein A) protecting the single strand until promotion of Polymerase Delta.
Exonuclease1 Activity: 5’  3’ directed
RPA (Replication Protein A)
Binds ssDNA, prevents degradation, promotes Polymerase δ,

7. Correction of Mismatch
Pol δ/ε
RFC
PCNA
RPA c
Repair DNA synthesis of the strand and correct base is accomplished by PCNA (Proliferating Cell Nuclear Antigen), RFC (Replication Factor C), polymerase delta and in some cases polymerase epsilon. The presence of all three proteins is necessary for efficient activity. RFC acts as a clamp loader and loads PCNA, the DNA clamp to the DNA strand. Together the two protein complexes hold polymerase delta securely in place. Polymerase delta then fills in the remaining single-stranded gap and DNA ligase seals the remaining nick.
DNA
Ligase
Nick
PCNA = Proliferating Cell Nuclear Antigen
RFC = Replication Factor C
Pol δ/ε = DNA Polymerase Delta/Epsilon

8. Mutator Phenotype
Mutations are a driving force behind cancer development
Mutated MMR genes
MLH1
Aberrant
MMR proteins
Replication errors bypass defective MMR systems
Enhanced proliferation
Mutations inactivate tumor suppressor genes and enable onco-genes (APC gene)
Mutated cells divide
A mutation in this sense is defined as any change in the nucleotide sequence of cellular DNA. A mutation in a gene responsible for preserving genomic stability would result in a cascade of downstream mutation events. A mutated MLH1 gene for instance would result in a mutated MMR protein. Thus base-base mismatches and insertion deletion loops would bypass deficient MMR systems. As mutations are not repaired, they accumulate and cause other mutations, inactivating tumor suppressor genes and enabling onco-genes. Mutated cells divide ultimately resulting in enhanced proliferation and tumorigenesis.
When normal cells are damaged beyond repair, they are eliminated by apoptosis. Cancer cells avoid apoptosis and continue to multiply in an unregulated manner.
To further understand the mutator phenotype phenomena, this flowchart illustrates the accumulation of mutation over a time frame of 20 years. DNA damage is first initiated by environmental or endogenous forces from which DNA damage repair mechanisms are expected to repair. Inability to repair mutations results in further downstream mutations and eventually repetitive selection for mutants and mutators. By the time the malignant phenotype has been identified clinically, many chemotherapeutic drugs are ineffective and the tumor has developed a clonal advantage over normal cells. Earlier detection of novel molecular markers and mutated cancer cells themselves could delay the accumulation of mutation. Coupled with early detection, drugs that target mutator pathways and specific genes could become efficacious in delaying malignant tumor growth.
unchecked growth
loss of apoptotic ability
acquisition of metastic ability
resistance to chemotherapeutic agents (6-TG, MNNG, 5-FU)

9. PAHs – The Environmental Influence
Mutagenic and carcinogenic - large nonpolar compounds
Exposure: diet, smoking, grilling food, fossil fuel processing
Metabolized forming highly reactive diol epoxides (DE)
Benzo[a]pyrene is metabolically activated to benzo[a]pyrene diol epoxide (BPDE) which binds to DNA forming bulky DNA adducts
PAH’s are a class of large nonpolar compounds resulting from the incomplete combustion of organic material. Human exposure can result from diet, smoking, grilling food, fossil fuel processing and diesel exhaust fumes. These nonpolar PAHs easily cross through the cell membrane where they are metabolized forming highly reactive diol epoxides (DE). The most common PAH, Benzo[a]pyrene is metabolically activated to benzo[a]pyrene diol epoxide (BPDE) which then binds to DNA forming DNA-adducts. Thus disrupting DNA replication and inducing increased mutation frequency.

10. Big Question Global Hypothesis
Specific combinations of environmental exposures and cellular deficiencies interact to influence cancer risk in individuals
Specific Hypothesis
MMR is a key pathway for reducing deleterious consequences (mutations) from PAH exposure
Prediction
Cells lacking MMR will show increased PAH-induced mutation

11. 3 Questions:
1.) General phenomena of MMR-deficiency?
2.) What are the extra mutations induced?
3.) General phenomena of PAH’s, in complex mixtures?

12. Hypothesis
We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines.
-Verify using DLD1 cell lines proficient and deficient in MSH6
We hypothesize that MMR-dependent suppression of BPDE-induced mutations represent a phenomenon generalizable to other PAH’s, including environmentally relevant complex mixtures.
We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines. This hypothesis can be addressed using DLD1 colon cancer cell lines, proficient and deficient in a different MMR protein MSH6. Inconsistent results between the HCT 116 and DLD1 lines would indicate that there are additional factors affecting the MF and cytotoxicity results.

13. BPDE-Induced Mutation
Forward mutations induced by exposure to PAH’s are measured using the reporter gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) 657bp
1 hour BPDE exposure
Doses: 0, 25, 50, 100 nM
HPRT+
HPRT-
Clear pre-existing mutants
HAT media –
5 passages
Bulky PAH-DNA adducts
Gene HPRT-
Protein HPRT+/-
Forward mutations induced by exposure to PAH’s are measured using the reporter gene hypoxanthine-guanine phosphoribosyl transferase (HPRT), as in previous experiments in the Buermeyer laboratory with BPDE. The HPRT enzyme plays an important role in DNA synthesis. MMR-deficient and MMR-proficient cell lines will first be cleared of preexisting HPRT mutants, followed by exposure to increasing concentrations of PAH to create PAH-DNA adducts. Cell cultures subsequently will be grown in selective culture medium containing the nucleotide analog 6-thioguanine, which is toxic to non-mutant HPRT+ cells. Growth in selective medium will allow for the HPRT-mutant cells to survive and develop into colonies. From these colonies, PAH-induced mutant frequencies can be calculated and compared between MMR-proficient and MMR-deficient cells.
Grown 8 days to insure no HPRT+ protein present
HPRT- mutant cells survive in
6-Thioguanine selective media
HPRT+
HPRT-

14. Cell Lines MMR Proficient MMR Deficient HCT 116 + Ch3 WT MLH1+
DLD1+Ch2
DLD1 WT
MSH6+
MSH6-

15. Mutant Frequency Calculation
MMR Proficient
MLH1
MMR Deficient
MLH1
135,000 cells
300 cells
6-TG selective media Non-selective media
135,000 cells
300 cells
6-TG selective media Non-selective media
few colonies ~150 colonies
more colonies ~150 colonies
Mutant frequency is determined by screening a known number of cells in medium containing the selective agent 6-TG to detect mutant cells, and in medium without selective agent to determine the cloning efficiency or cell viability. After an appropriate incubation time (12-14 days), colonies are stained and counted. The mutant frequency is determined from the number of colonies formed in selective medium and normalized using the number of viable colonies formed in the non selective media.
MF=6-TG resistant colonies formed/(PE x # of plates)
MF=mutant frequency
PE = plating efficiency

16. Results: PAH-induced mutation in MSH6- deficient cells, similar to previous MMR+ proficient cells
Technical issue with low plating efficiency in MSH6+

17. Mutation Identificationv
trypsinized cloning disc
RNA was extracted from HCT 116+Ch2 cells using trypsinized cloning discs. The disc and mutant colony were both moved to a 12-well plate. Upon confluency, the clone was expanded into a 6-well plate from which it was then centrifuged into a pellet. The pellets were purified using spin technology. Samples are first lysed and then homogenized. Ethanol is added to the lysate to provide ideal binding conditions. The lysate is then loaded onto the RNeasy silica membrane (see figure "RNeasy Mini spin column"). RNA binds, and all contaminants are efficiently washed away. Pure, concentrated RNA is eluted in water.
Centrifuge
Total RNA Purification

18. RNA  cDNA PCR sequence
Reverse Transcriptase - PCR
cDNA
PCR – amplify HPRT gene
Primers
P3: -36 to ’ CCTGAGCAGTCAGCCCGCGC 3’
P4: 701 to ’ CAATAGGACTCCAGATGTTT 3’
First strand cDNA was synthesized via reverse transcript PCR. Amplification of cDNA was performed by an additional PCR step. The DNA was then quantified by agarose gel electrophoresis. Diluted primers and proper amounts of DNA was sent to the CGRB Core lab for final processing.
Sequencing
agarose gel electrophoresis

19. Agarose Gel Electrophoresis
Mutant:
CONTROLS
Batch 3 PCR Products – HCT HPRT Mutants
HPRT product
657bp

20. Spectrum of HPRT Mutations
Spectrum Key
58.3%
AT → GC transition
Insertion of one nucleotide base
GC → CG transversion
GC → TA transversion
4.2%
Deletion of one nucleotide base
25.0%
GC → AT transition
12.5%

21. Conclusion Preliminary data suggest:
BPDE-induced spectra in MLH1 deficient cells different from spontaneous mutations
Too soon to tell if induced spectra differs in MMR proficient vs. deficient cell lines

22. Future Investigations
Continue mutant analysis on remaining clones:
HCT 116+Ch2
HCT 116+Ch3
DLD1
DLD1+Ch2
Complex environmental mixtures
Mutant frequency
Individual mutation analysis
Human exposure to individual PAHs is rare, whereas exposure to mixtures of PAHs is common. Access to mixtures of PAH’s with the collaboration of Kim Anderson’s laboratory at Oregon State University could allow further research and insight on the additive, synergistic or antagonistic effects of PAHs in mixtures. Results obtained from the relationship between MMR and PAH mixtures would broaden our understanding of an individual’s susceptibility to developing cancer.

23. Goals Research Goals & Significance
Understand MMR functions as well as genetic influences and their combined role in normal responses to carcinogens
Accurate evaluation of an individuals susceptibility and risk to developing CRC
Provide insight for more effective and practical CRC screening methods
Develop novel models for studying other genetic and environmentally linked diseases

24. Acknowledgements Howard Hughes Medical Institute
Environmental Health Sciences Center
Dr. Andrew Buermeyer
Jacki Coburn
Fatimah Almousawi
Kimberly Sarver
Dr. Vidya Schalk
Dr. Kevin Ahern, program coordinator