1. Volume 120, Issue 2, Pages 439-448 (February 2001)
Glycine supply to human enterocytes mediated by high-affinity basolateral GLYT1 
Graham R. Christie, Dianne Ford, Alison Howard, M.Ann Clark, Barry H. Hirst 
Gastroenterology 
Volume 120, Issue 2, Pages (February 2001)
DOI: /gast
Copyright © 2001 American Gastroenterological Association Terms and Conditions

2. Fig. 1
Time course of basolateral glycine uptake in Caco-2 cells. Basolateral uptake (pmol · cm−2 · min−1) of glycine (50 μmol/L) was measured over time in the presence of both Na+ and Cl− (■), in the absence of Na+ (▴), and in the absence of Cl− (▾) Inset: Comparison of glycine uptake across the basolateral and apical surfaces of Caco-2 cells. Glycine (50 μmol/L) uptake was measured over 10 minutes in the presence of Na+ and Cl−, simultaneously across apical and basolateral surfaces, with [3H]glycine and [14C]glycine, respectively. Results are means ± SE (n = 6).
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

3. Fig. 2
Sensitivity of Na+- and NaCl-dependent basolateral glycine uptake in Caco-2 cells to inhibition by alanine. (A) Basolateral uptake (pmol · cm−2 · min−1) of glycine (50 μmol/L) was measured over 10 minutes under 3 different conditions: in the presence of both Na+ and Cl− (■), in the absence of Na+ (▴), and in the absence of Cl− (▾). (B) Uptake measured under Na+-free conditions was subtracted from uptake values measured in the presence of both Na+ and Cl− and Cl−-free conditions to calculate Na+-dependent (■) and NaCl-dependent (▴) uptake, expressed as pmol · cm−2 · min−1. Alanine was present at various concentrations (0–10 mmol/L). Results are means ± SE (n = 6).
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

4. Fig. 3
Relative contribution of different components to basolateral uptake of glycine in Caco-2 cells. (A) In the absence of alanine (0 mmol/L Ala), 17% of total basolateral glycine uptake is Na+ independent, 31% is Na+ dependent, and 52% is Na+ and Cl− dependent. (B and C) In the presence of 5 mmol/L alanine (5 mmol/L Ala), total glycine uptake is reduced by 60%. (B) The Na+-dependent component now represents only 4% of total glycine uptake and the Na+-independent component only 5% of total glycine uptake. The remaining 91% is due to Na+- and Cl−-dependent mechanisms. (C) Of the alanine-insensitive component, 74% is inhibited by sarcosine, a characteristic of GLYT1-mediated uptake. GLYT1, therefore, is responsible for approximately 30%–50% of total basolateral glycine uptake.
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

5. Fig. 4
Kinetics of basolateral GLYT1-mediated glycine uptake in Caco-2 cells. Basolateral uptake (pmol · cm−2 · 10 min−1) of glycine (1–250 μmol/L) was measured in the presence of 5 mmol/L alanine, Na+, and Cl− over 10 minutes. Total uptake (▴) is compared with specific uptake (■; after subtraction of uptake in the presence of an excess of glycine [1 mmol/L]). The data obeyed Michaelis–Menten kinetics describing a single transport system, with similar values for Vmax and apparent Km estimated by 2 methods (see Results). Results are expressed as mean ± SE (n = 6).
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

6. Fig. 5
Effect of PMA on kinetics of GLYT1-mediated basolateral glycine uptake in Caco-2 cells. Basolateral uptake of glycine (1–250 μmol/L) was measured in the presence of 5 mmol/L alanine, Na+, and Cl− over 10 minutes. Cells treated with PMA were incubated 4 hours before measurement of glycine uptake. The data for both control (■) and PMA-treated (▴) cells obeyed Michaelis–Menten kinetics describing a single transport system. Analysis of the data gave Vmax values of 2.7 ± 0.3 pmol · cm−2 · min−1 for PMA-treated cells compared with 9.9 ± 0.4 pmol · cm−2 · min−1 for control, and Km values of 37 ± 16 μmol/L for PMA-treated cells compared with 43 ± 5 μmol/L for control. Results are expressed as mean ± SE (n = 6).
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

7. Fig. 6
Intestinal expression of GLYT1. (A) RT-PCR products from Caco-2 cells and human intestine using GLYT1-specific primers. Products were run on a 2% agarose gel and stained with ethidium bromide. Lane 1, molecular weight markers with sizes indicated; lanes 2 and 3, Caco-2 poly(A)+ RNA amplified with GLYT1-specific primers; lanes 4 and 5, human ileum poly(A)+ RNA amplified with GLYT1-specific primers; lanes 6 and 7, Caco-2 poly(A)+ RNA amplified with β-actin–specific primers (positive control); lanes 8 and 9, human ileum poly(A)+ RNA amplified with β-actin–specific primers (positive control). MMuLV-RT was omitted from the reactions run in lanes 3, 5, 7, and 9 (negative control). Western blot analysis of Caco-2, JAR, and human brain protein for GLYT1. Twenty micrograms of protein from each source was run on a 7.5% acrylamide gel, transferred to nitrocellulose, and probed with an anti-GLYT1 antibody. Lane 1, Caco-2 cell extract; lane 2, JAR cell extract; lane 3, human brain extract. No bands were visible in this molecular weight range on a control blot incubated with normal rabbit serum.
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

8. Fig. 7
Localization of GLYT1 in human intestine. CLSM images of frozen sections of human small intestine stained for GLYT1. (A) Optical section (low-power view) showing GLYT1 expression in both apical and basolateral membranes of cells distributed throughout the crypt-villus axis. (C–E) Optical sections (high-power views), again showing GLYT1 expression in both apical and basolateral membranes of cells located at the (C) base, (D) midregion, and (E) tip of a single villus. In the absence of anti-GLYT1 antibody (B, optical section of midregion villus), staining by the FITC-conjugated detecting antibody is negligible. (B and C were collected and displayed using identical parameters). L, gut lumen. Bar = 50 μm (A); 10 μm (B–E).
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

9. Fig. 8
Localization of GLYT1 in Caco-2 cell monolayers. CLSM images of Caco-2 cell monolayers stained for GLYT1. (A–C) Z-series of optical sections showing GLYT1 expression in the (A) apical (surface), (B) lateral (8 μm depth), and (C) basal (14 μm depth) membranes. (D) In the absence of GLYT1 antibody (optical section at midregion of cells), staining by the FITC-conjugated detecting antibody is negligible. (Images A–D were collected and displayed using identical parameters.) (E) Vertical section of test sample; GLYT1 expression is again observed in both apical and basolateral membranes. Bars = 10 μm.
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

10. Fig. 9
Competitive, quantitative RT-PCR analysis of GLYT1 mRNA expression. For measurement of GLYT1 mRNA levels in each sample, a series of 8 RT reactions was performed. Each reaction contained an identical amount of sample (Caco-2) poly(A)+ RNA and a known amount of internal standard synthetic complementary RNA, incorporating a 100-bp deletion, which increased each time by a factor of 2. After PCR amplification with a pair of GLYT1-specific primers, products were separated on a 2% agarose gel and stained with ethidium bromide. Internal standard and GLTY1 complementary DNAs compete for amplification, thus the signal generated by the internal standard (220 bp) becomes progressively weaker as the GLYT1 signal (320 bp) becomes progressively stronger. The amount of GLYT1 mRNA in the test sample was determined from a plot of log10 signal ratio vs. log10 (internal standard) as the point where the signal ratio was equal to one. β-Actin mRNA levels in all samples were determined in the same way using the primers 2581TCCACGAAACTACCTTCAAC2600 and 3295TTTAGGATGGCAAGGGAC3278 (based on the human β-actin gene sequence; GenBank accession no. M10277) and an internal standard incorporating a 143-bp deletion.
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions

11. Fig. 10
Effect of inhibitors of transcription and translation on PKC regulation of GLYT1-mediated glycine uptake in Caco-2 cells. Caco-2 cells were treated for 4 hours with 5 μg/mL actinomycin D or 50 μg/mL cyclohexamide in the presence or absence of 1 μmol/L PMA, and basolateral glycine uptake was measured in the presence of NaCl and 5 mmol/L alanine. Neither actinomycin D nor cyclohexamide reduced significantly glycine uptake. The inhibitory effect of PMA on glycine uptake persisted in the presence of both actinomycin D and cyclohexamide. Results shown are mean ± SEM (n = 3). *P < 0.001, analysis of variance followed by Bonferroni multiple comparisons test.
Gastroenterology  , DOI: ( /gast )
Copyright © 2001 American Gastroenterological Association Terms and Conditions