Presentation is loading. Please wait.

Presentation is loading. Please wait.

A Novel Recessive Connexin 31 (GJB3) Mutation in a Case of Erythrokeratodermia Variabilis  Alessandro Terrinoni, Aida Leta, Cristina Pedicelli, Eleonora.

Published byあきたけ のたけ Modified over 5 years ago

Similar presentations

Presentation on theme: "A Novel Recessive Connexin 31 (GJB3) Mutation in a Case of Erythrokeratodermia Variabilis  Alessandro Terrinoni, Aida Leta, Cristina Pedicelli, Eleonora."— Presentation transcript:

1 A Novel Recessive Connexin 31 (GJB3) Mutation in a Case of Erythrokeratodermia Variabilis 
Alessandro Terrinoni, Aida Leta, Cristina Pedicelli, Eleonora Candi, Marco Ranalli, Pietro Puddu, Mauro Paradisi, Corrado Angelo, Giacinto Baggetta, Gerry Melino  Journal of Investigative Dermatology  Volume 122, Issue 3, Pages (March 2004) DOI: /j X x Copyright © 2004 The Society for Investigative Dermatology, Inc Terms and Conditions

2 Figure 1 Clinical presentation and histopathology. (a) Diffuse ichthyotic hyperkeratosis, characterized by thick dark brown scales and erythematous patches of body skin, changing in size and shape in the course of weeks, leaving some areas completely unaffected. (b) Hyperkeratosis of palms. (c) Hematoxylin–eosin staining of patient skin sections, showing orthohyperkeratosis, papillomatosis and light superficial dermal lymphocytic infiltration. (d) Clinical presentation of the patient after Acitretin treatment. The dark brown scales have almost disappeared, while erythematous patches are still present. Journal of Investigative Dermatology  , DOI: ( /j X x) Copyright © 2004 The Society for Investigative Dermatology, Inc Terms and Conditions

3 Figure 2 Pedigree, mutation analysis and enzymatic digestion for confirmation analysis. (a) Pedigree of the patient's maternal and paternal family shows the presence of a common ancestor. Asterisks indicate the individuals for whom the DNA was available for mutational analysis. (b–d) Sequence analysis of the Cx31 gene, performed on patient cDNA (RT-PCR) and genomic DNA (PCR) and only on genomic DNA (PCR) for all the other members. The primers used are ACTCAGAACACTGCCTGGTACATA (+) and GGCACTGGGCCTGTGGGTTAC (-), designed from the published sequence (AF099030). Wild-type guanine 829 is represented by a single black peak in the chromatogram (black arrow in panel d). The green peak at position 829 indicates a Timine residue (black arrow in panel b), which leads to the amino acid substitution Glu100Lys. In panel c, the presence of two peaks (black/green indicated by the arrow) reveals the presence of both alleles in heterozygous individuals. (e) The G to A transversion ablates an existing BseR-I restriction site. The digestion with this enzyme of the 1117 bp amplicon produces two bands (703 bp, 414 bp, lane 7) for the wild-type allele, three bands in the presence of the heterozygous mutation (1117 bp, 703 bp, 414 bp, lanes 1–2–4–5–6–8) and one band when both alleles are mutated (1117 bp, lane 3). The results indicate that the patient's parents and most other relatives (with one exception) are heterozygous for the mutation. Journal of Investigative Dermatology  , DOI: ( /j X x) Copyright © 2004 The Society for Investigative Dermatology, Inc Terms and Conditions

Download ppt "A Novel Recessive Connexin 31 (GJB3) Mutation in a Case of Erythrokeratodermia Variabilis  Alessandro Terrinoni, Aida Leta, Cristina Pedicelli, Eleonora."

Similar presentations

Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy 

Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy 
DNA-based prenatal exclusion of harlequin ichthyosis

DNA-based prenatal exclusion of harlequin ichthyosis
A Novel Mutation and Large Size Polymorphism Affecting the V2 Domain of Keratin 1 in an African-American Family with Severe, Diffuse Palmoplantar Keratoderma.

A Novel Mutation and Large Size Polymorphism Affecting the V2 Domain of Keratin 1 in an African-American Family with Severe, Diffuse Palmoplantar Keratoderma.
Expression of Transglutaminase 5 in Normal and Pathologic Human Epidermis  Eleonora Candi, Sergio Oddi, Andrea Paradisi, Alessandro Terrinoni, Marco Ranalli,

Expression of Transglutaminase 5 in Normal and Pathologic Human Epidermis  Eleonora Candi, Sergio Oddi, Andrea Paradisi, Alessandro Terrinoni, Marco Ranalli,
Dominant De Novo Mutations in GJA1 Cause Erythrokeratodermia Variabilis et Progressiva, without Features of Oculodentodigital Dysplasia  Lynn M. Boyden,

Dominant De Novo Mutations in GJA1 Cause Erythrokeratodermia Variabilis et Progressiva, without Features of Oculodentodigital Dysplasia  Lynn M. Boyden,
Herlitz Junctional Epidermolysis Bullosa: Novel and Recurrent Mutations in the LAMB3 Gene and the Population Carrier Frequency  Aoi Nakano, Ellen Pfendner,

Herlitz Junctional Epidermolysis Bullosa: Novel and Recurrent Mutations in the LAMB3 Gene and the Population Carrier Frequency  Aoi Nakano, Ellen Pfendner,
Transient Bullous Dermolysis of the Newborn Associated with Compound Heterozygosity for Recessive and Dominant COL7A1 Mutations  Nadja Hammami-Hauasli,

Transient Bullous Dermolysis of the Newborn Associated with Compound Heterozygosity for Recessive and Dominant COL7A1 Mutations  Nadja Hammami-Hauasli,
Identification of a Novel Mutation and a De Novo Mutation in DKC1 in Two Chinese Pedigrees with Dyskeratosis Congenita  Ying-guo Ding, Tie-shan Zhu, Wei.

Identification of a Novel Mutation and a De Novo Mutation in DKC1 in Two Chinese Pedigrees with Dyskeratosis Congenita  Ying-guo Ding, Tie-shan Zhu, Wei.
Olmsted Syndrome Caused by a Homozygous Recessive Mutation in TRPV3

Olmsted Syndrome Caused by a Homozygous Recessive Mutation in TRPV3
Combination of a Novel Frameshift Mutation (1929delCA) and a Recurrent Nonsense Mutation (W610X) of the LAMB3 Gene in a Japanese Patient with Herlitz.

Combination of a Novel Frameshift Mutation (1929delCA) and a Recurrent Nonsense Mutation (W610X) of the LAMB3 Gene in a Japanese Patient with Herlitz.
Severe Palmo-Plantar Hyperkeratosis in Dowling–Meara Epidermolysis Bullosa Simplex Caused by a Mutation in the Keratin 14 Gene (KRT14)  Carrie S. Shemanko 

Severe Palmo-Plantar Hyperkeratosis in Dowling–Meara Epidermolysis Bullosa Simplex Caused by a Mutation in the Keratin 14 Gene (KRT14)  Carrie S. Shemanko 
Aoi Nakano, Hajime Nakano, Sal LaForgia, Leena Pulkkinen, Jouni Uitto 

Aoi Nakano, Hajime Nakano, Sal LaForgia, Leena Pulkkinen, Jouni Uitto 
Olmsted Syndrome Caused by a Homozygous Recessive Mutation in TRPV3

Olmsted Syndrome Caused by a Homozygous Recessive Mutation in TRPV3
Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy 

Epidermolysis Bullosa: Novel and De Novo Premature Termination Codon and Deletion Mutations in the Plectin Gene Predict Late-Onset Muscular Dystrophy 
Mild Recessive Bullous Congenital Ichthyosiform Erythroderma due to a Previously Unidentified Homozygous Keratin 10 Nonsense Mutation  Akiko Tsubota,

Mild Recessive Bullous Congenital Ichthyosiform Erythroderma due to a Previously Unidentified Homozygous Keratin 10 Nonsense Mutation  Akiko Tsubota,
Analysis of Rare APC Variants at the mRNA Level

Analysis of Rare APC Variants at the mRNA Level
A Recurrent Intragenic Deletion in the Desmoglein 4 Gene Underlies Localized Autosomal Recessive Hypotrichosis  Celia Moss, Amalia Martinez-Mir, HaMut.

A Recurrent Intragenic Deletion in the Desmoglein 4 Gene Underlies Localized Autosomal Recessive Hypotrichosis  Celia Moss, Amalia Martinez-Mir, HaMut.
Mutations in the ABCC6 Gene as a Cause of Generalized Arterial Calcification of Infancy: Genotypic Overlap with Pseudoxanthoma Elasticum  Qiaoli Li, Jill.

Mutations in the ABCC6 Gene as a Cause of Generalized Arterial Calcification of Infancy: Genotypic Overlap with Pseudoxanthoma Elasticum  Qiaoli Li, Jill.
Genetic Heterogeneity in Erythrokeratodermia Variabilis: Novel Mutations in the Connexin Gene GJB4 (Cx30.3) and Genotype-Phenotype Correlations  Gabriele.

Genetic Heterogeneity in Erythrokeratodermia Variabilis: Novel Mutations in the Connexin Gene GJB4 (Cx30.3) and Genotype-Phenotype Correlations  Gabriele.
Splice Site and Deletion Mutations in Keratin (KRT1 and KRT10) Genes: Unusual Phenotypic Alterations in Scandinavian Patients with Epidermolytic Hyperkeratosis 

Splice Site and Deletion Mutations in Keratin (KRT1 and KRT10) Genes: Unusual Phenotypic Alterations in Scandinavian Patients with Epidermolytic Hyperkeratosis 

Similar presentations

Ads by Google