1. Bioinformatics Necessary evil, panacea, or just a useful tool?
With a month in the lab you can easily prevent having to sit an hour in front of the computer.
Nothing is impossible for a biologist who doesn’t have to discover it him/her-self.

2. Bio + informatica

3. Humaan genoom

4. Humaan genoom
....acccaagaagtcagaatcctcgaagctgaagcctgactgtaatcctcgaagctgaagcctgactgtaagctctgcctcctac
aactaatcctcgaagctgaagcctgactgtagacaagtcacaatgcaacccctttgctccagaggaaaaggagtaagcacagaggg
cttctgagtccggcaatgctcaatcctcgaagctgaagcctgactgtcatttcctgacaggagcattttacagacttgcgtctgcc
cctctgagggaggcagggccatcagctaacactcagagacaatcctcgaagctgaagcctgactgtaaggatggtcctacaacatc
ctgatctgggaggaagaggtgaaggcaactcaccaccctaatcctcgaagctgaagcctgactgtaatcctcgactgtcaggcaaca
gtggaactaaggctcattctaaagaatgtgcccaagatcaaatcctcgaagctgaagcctgactgtcacaccgaaggctgcaaagc
gagagtcaaacttggaatcttaacagaaaccctgaacctgcacttgtccctttacactgctcttaacagaaacctgcagcatgg
atgcgatggctgggcagagggaagtgcccaagcctgaatcctcgaagctgaagcctgactgtgggacaaaaatgcctacctg....

5. Chromosomes

6. Genome annotation

7. Bioinformatics and medicines
One day we know everything about all human (and flu) proteins and then can we start to ‘calculate’ flu-medicines.

8. Drug Design

9. GPCR

10. Drug Design

11. Mens vs parasiet
Parasite
Active site

12. Medicine
Every small molecule is, in principle, a poison. We call it a flu-medicine if it kills the flu much faster than the patient.

13. H1N1 / H5N1

14. H1N1

15. Strange mortality 1918 (the 1918 flu was H1N1)

16. Same strange mortality in Mexican H1N1? Why?

17. Flu bioinformatics
Determine which variant it is from sequence comparisons
Design medicine(s) (tamivir, etc)
Determine why H1N1 is dangerous
Predict next variant

18. Bird/pig flu

19. Pig flu pandemic?

20. H5N1 (but H1N1 also went through birds)

21. Neuraminidase Quote from Wikipedia/WHO/etc:
On February 27, 2005, a 14-year-old Vietnamese girl was documented to be carrying an H5N1 influenza virus strain that was resistant to the drug oseltamivir. However, the Vietnamese girl who had received a prophylactic dose (75 mg once a day) was found to be non-responsive to the medication. In growing fears of a global avian flu pandemic, scientists began to look for a cause of resistance to the Tamiflu medication. The cause was determined to be a histidine-to-tryosine substitution at position 274 in its neuraminidase protein.

22. H1N1 medicijn