1. BIOTECHNOLOGY
EQ: How is society influenced by biotechnology?

2. THINK
What is a GMO?
Is it better when a food says “No GMOs added” or “Non-GMO product”?
Would you eat a GMO?

3. You all eat them!!!! They are in frosted flakes, nana’s sweet potato pie, and the snacks that you eat in class

4. Objectives
Evaluate examples and explain the possible impact of biotechnology on the individual, society, and the environment.
You will NOT be tested on the following methods of biotech. You WILL be tested on the impacts of each method.

5. Before We Get Rollin…
Genes- unit of heredity passed from parent to offspring
AKA pieces of DNA

6. Genetics: Fundamentals
Genome:
An organism's complete set of DNA, including all of its genes.
Each genome contains all of the information needed to build and maintain that organism
Through biotechnology the organism’s genome can be altered.
Human Genome Project – completed in 2003 several years ahead of schedule due to the use of biotechnology techniques such as PCR (polymerase chain reaction- makes many copies of a particular DNA sequence (amplifies the DNA))
Human Genome Project: found the sequence of nucleotides in human DNA, and identified the genes within the sequence

7. What’s in our genes??? Karyotype – shows abnormalities in chromosomes
Cells in metaphase –
used to see visible chromosomes
chromosomes are arranged in
ordered pairs
Shows extra or missing chromosomes
Ask students do they notice any differences between the two sets of chromosomes. Allow students to identify the difference before explaining. They both are females but the bottom one has an extra chromosome at 21 which is downs syndrome. There are other diagnosis that can be determined from Karyotyping. Leave the conversation there and allow students to post additional questions on the parkinglot.

8. What is Biotechnology?
Biotechnology is the changing of an organisms DNA to give the organism new traits
Examples:
Pest-resistant crops-
a gene from a bacteria is inserted
into the crop to kill bugs that try
To eat it
Golden Rice- genetically
altered to produce more
Vitamin A

9. GMO Production
Transgenic organisms are the result of introducing a new gene from a different species, producing a genetically modified organism (GMO).
Trans means “across”
Genetic is an organism’s DNA
Ex: Golden rice is a transgenic
form of rice
Golden rice- transgenic rice with beta-carotene used to prevent Vitamin A deficiency and prevent blindness in much of the world.

10. Okay great… we can make more nutritious rice and corn
Okay great… we can make more nutritious rice and corn. Why else is biotechnology important?
Finding out who done it!

11. Created through Gel Electrophoresis - Used for crime scene detection
DNA Fingerprinting
DNA fingerprinting is a test to identify unique individual patterns in DNA
Created through Gel Electrophoresis
- Used for crime scene detection
DNA fingerprinting: Fragmentation patterns from different individuals can be compared to each other to establish paternity.

12. DNA fingerprinting and Gel Electrophoresis
DNA samples are cut with the same restriction enzymes to create DNA fragments
Electrical current pulls DNA fragments through the gel to separate DNA fragments by length
Each sample is loaded into the gel for comparison to known DNA.
Restriction maps show the length of DNA fragments
The largest DNA pieces are at the top with a graduation of decreasing size as you look towards the bottom. There are two sets of DNA on this gel to get more information efficiently. Each lane has a different sample or “digest” that is compared to a standard digest with pieces of known sizes.
Extension Information: DNA is separated by size because all DNA has a negative charge due to the phosphate groups; there is a negative electrode at the top (cathode) and a positive one at the bottom (anode).

13. What uses do you think there are for DNA fingerprints?
Criminal cases
Paternity tests
Immigration
Studying biodiversity
Tracking genetically modified crops

14. PCR- Polymerase Chain Reaction
Produces large amounts of DNA (millions or billions!) from a small sample
used in DNA cloning, medical diagnostics, and forensic analysis of DNA

15. Genetic Engineering and Recombinant DNA
Genetic Engineering: changing an organism’s DNA to give it new traits
GMOs, “designer” babies
Recombinant DNA: contains gene fragments from more than one organism
Pieces of DNA can be added to the DNA of another organism artificially (gene cloning)
The piece of DNA encodes a useful protein, and the bacteria are used as “factories” to make the protein.
make insulin used by diabetics

16. How does the genome get altered??
Restriction enzymes act as “molecular scissors.”
come from various types of bacteria
cut DNA at a specific nucleotide sequence called a restriction site
“Molecular scissors”; restriction enzymes are one of several tools in the biotechnology tool box.
Extension Information:.

17. Biotechnology and Genetic Testing: Treatment options
Gene therapy-
using an inactive virus to replace a defective gene
Use to treat or even prevent disease
cystic fibrosis, hemophilia, heart disease

18. Biotechnology and Genetic Testing: Treatment Options
2. Gene cloning-
the process of making multiple, identical copies of a particular piece of DNA
produces large amounts of compounds for treatment (ex., cloned insulin for diabetes patients)

19. Biotechnology and Genetic Testing: Treatment Options
3. Pharmacogenetics
The study of variability in drug response due to heredity
determining drug treatment choice and dosage based in individual DNA

20. Check For Understanding
Discuss with your group. Select an answer and write your reasoning in your journal
Your family is known to have Huntington's disease. Huntington's is a sex-linked disease that causes its victims to slowly lose their ability to speak, walk and function. Ultimately, Huntington's causes death. There is a test that will tell you whether you have or carry the gene for Huntington's disease. What do you do?
I would take the test, so that I would be better prepared for the future, and could make sure my family was taken care of.
I would not want to know.

21. Check For Understanidng
Discuss with your group. Select an answer and write your reasoning in your journal
An agricultural company has found a way to make tomatoes 50% larger by splicing elephant genes into the tomatoes. Will you:
Buy the tomatoes and have no problem eating them
Probably not buy or eat the tomatoes
Protest the company.

22. Check for Understanding
Biotechnology includes several laboratory techniques that have impacted the understanding of diseases that could lead to better treatments or cures. What would be the most beneficial and ethical use of biotechnology in medical research?
A. boosting the genetic yield of enzymes that would increase muscle strength in athletes
B. controlling the skin pigmentation genes to prevent freckles, moles, and birthmarks
C. producing “designer babies” that express the parents’ preferred eye or hair color
D. replacing mutated genes with functional ones to correct disorders such as diabetes

23. Who ate the Caviar?
The incident report and procedures are on the pink sheet. Read through it.
What pattern are you looking for in the DNA?
Where is the restriction site?
After making the cuts, what do you need to do with each DNA fragment?

24. Instructions (example with Suspect 1)
1. In each sequence of DNA look for the pattern CCGG in the TOP strand of DNA:
Suspect One DNA
GTCGACCGGTGACCGTGCGTACACAGTGCTCCGGATAGCTGATAGCTCCGGTG
CAGCTGGCCACTGGCACGCATGTGTCACGAGGCCTATCGACTATCGAGGCCAG
2. Make a “cut”(line) between CC and GG:
3. Count the number of base pairs (nucleotides) in each fragment and write it underneath:

25. Instructions
Under suspect one, find the number for the base pairs in the first fragment (7) and color in that box
Do the same for the remaining fragments in suspect one (25, 17, 4)

26. Do the same for each of the remaining suspect and the provided Crime Scene DNA
*Careful, Not everyone has the same crime scene DNA!!
This is using DNA finger printing to create a Restriction Map through gel electrophoresis!!

27. Who Ate the Caviar? In your group of 4, complete the lab to figure out
who at the caviar!
C- level 2 voice (no one should hear you but your partner)
H- Ask three before me (then raise your hand)
A- Complete the “Who ate the Caviar” lab within the 18 min time frame
M- Remain seated (butt on stool) with your group
P- work with your table partner SUCCESS