Presentation is loading. Please wait.

Presentation is loading. Please wait.

RNA Structure and Protein Synthesis

Similar presentations


Presentation on theme: "RNA Structure and Protein Synthesis"— Presentation transcript:

1 RNA Structure and Protein Synthesis
GT Biology Feb. 23, 2011 RNA Structure and Protein Synthesis

2 Warm-up How does DNA replicate? What is the central dogma?
Quiz on Thursday March 3rd

3 Objective SWBAT explain the structure of RNA, its role in protein synthesis and how proteins are synthesized

4 Homework Read pgs Complete questions 1-6

5 Today RNA Structure Types of RNA

6 RNA Structure

7 What is RNA? RiboNucleic Acid
It is involved in the relaying of genetic information from DNA to the cytoplasm of the cell to produce proteins The production of proteins is known as protein synthesis RNA is found in the nucleus and the cytoplasm

8 RNA Structure Like DNA, RNA is made of nucleotides which contain:
A sugar called ribose A phosphate group One of 4 nitrogenous bases Cytosine Guanine Adenine Uracil (this is in the place of thymine)

9 RNA Structure Cont. Single helix There are 3 types of RNA:
Messenger RNA (mRNA) Transfer RNA (tRNA) Ribosomal RNA (rRNA)

10 Messenger RNA (mRNA) Carries the genetic information from the DNA in the nucleus to ribosomes in the cytoplasm

11 Transfer RNA (tRNA) Match the proper amino acid with the mRNA code to produce a protein Each tRNA contains an anticodon which contains 3 bases the correspond the codons on the mRNA Amino Acid

12 Ribosomal RNA (rRNA) Make up the ribosome (this is where proteins are made) These also allow mRNA to attach to the ribosome

13

14 Contain the genetic information
DNA vs RNA Type of Nucleic Acid DNA RNA Sugar Nitrogenous Bases Structure Location Function Deoxyribose Ribose A,T,G,C A,U,G,C Double Helix Single Helix Nucleus and Cytoplasm Nucleus Contain the genetic information Protein formation

15 Protein synthesis

16

17 Protein Synthesis Begins in the nucleus with the DNA
mRNA is created by a process called transcription

18 Transcription The first step in transcription is to “unzip” the DNA
Just like in replication this means the weak hydrogen bonds must be broken Next RNA polymerase matches complimentary RNA to the DNA C with G A with U instead of T Once the mRNA has been created the DNA strand closes back up

19 Transcribe the DNA DNA: ATGGCACTGCAT mRNA: UACCGUGACGUA

20 Translation After transcription the mRNA leaves the nucleus and enters the cytoplasm Once in the cytoplasm the mRNA attaches to a ribosome to begin making proteins The ribosome moves down the mRNA and “reads” the information The information on mRNA is read in codons (a groups of 3 bases)

21 Codons 3 bases make up 1 codon
Each codon corresponds to a specific amino acid Amino acids are the building blocks of proteins Amino acids can be found free floating in the cytoplasm To determine what amino acid each codon codes for there is a codon table

22 ACU CGA GGC UAA Thr Arg Gly STOP

23 Translation The end of the protein is signaled by the reading of 1 of the 3 stop codons The series of amino acids produced by the ribosome create a protein Each protein produced plays a specific role in the appearance and behavior of the organism

24

25 Putting It All Together
Beginning in the nucleus, DNA is unzipped so mRNA strands can be created from the template The mRNA strand exits the nucleus and enters the cytoplasm The mRNA attaches to the ribosome which is composed of rRNA The ribosome reads the mRNA with each codon producing a different amino acid, the amino acids are brought in by tRNAs The amino acids string together to create proteins

26

27 The Central Dogma DNA RNA Protein

28 What Protein Is Produced?
DNA: GTTATCCTTCGCAATCACATTGCG mRNA: Protein: GUUAUGGAAGCGUUAGUGUAACGC --- Met Glu Ala Leu Val STOP ---

29 Practice


Download ppt "RNA Structure and Protein Synthesis"

Similar presentations


Ads by Google