1. Draw a DNA molecule made from the 4 different nucleotides
Draw a DNA molecule made from the 4 different nucleotides. Label each of the following one time:
Hydrogen Bond Deoxyribose
Phosphate Adenine
Thymine Cytosine
Nucleotide Guanine

2. Objective 4.1
ID the structure and function of DNA on a molecular level.

3. DNA Rap

4. DNA
Structure/Function

5. REVIEW… NUCLEIC ACIDS!!! DNA 4 classes of macromolecules Carbohydrates
Lipids
Proteins
NUCLEIC ACIDS!!!
Building blocks are NUCLEOTIDES
DNA

6. I. DNA DNA – deoxyriboNUCLEIC ACID Very long thin molecule made
up of linked nucleotides
C. Double stranded helix
Twisted ladder
D. A code for EVERY
LIVING ORGANISM. Essential for the genetic code.

7. II. Nucleotide Structure
3 parts
A. Sugar (deoxyribose)
B. Phosphate (P with oxygens attached)
C. Nitrogen base
Adenine (A)
Guanine (G)
Thymine (T)
Cytosine (C)

8. (2 rings)
(1 Ring)
A’s
are Golden!

9. III. How Nucleotides fit together
Sides of ladder – alternating sugars and phosphates
Antiparallel=orientation of the 2 strands is
opposite. Ex. 5’ to 3’
3’ to 5’
B. Steps of the ladder – connect to the sugar
The “steps” connect to these!

10. I. Nitrogen Base Pairing Complementary (You Complete Me)
Adenine Thymine
4-eva
Guanine Cytosine

12. What is the COMPLEMENTARY DNA STRAND?
EXAMPLE 1
3’ end ’ end
ATTGACCATTGATAGCCGAATA
TAACTGGTAACTATCGGCTTAT
EXAMPLE 2
5’ end ’ end
TCTTCGGAACATTAGTCGAGGC
AGAAGCCTTGTAATCAGCTCCG

13. Nitrogen Base Pairing-held together by Hydrogen bonds
Adenine Thymine
Cytosine Guanine
Thymine Adenine
Adenine Thymine
Guanine Cytosine

14. Nitrogen Base Pairing Adenine Thymine Cytosine Guanine Thymine Adenine
Guanine Cytosine

15. Chargaff’s Rule The # of A’s = The # of T’s
The # of G’s = The # of C’s

16. Critical Thinking! If 18% of the DNA molecule is comprised of Adenine.
What % do we have of Thymine, Cytosine & Guanine?

17. C. Describe the Double Helix shape:
Twisted ladder composed of N bases that make up the steps connected by H bonds.
Sides are alternating sugars and phosphates.

18. DNA storage
A. DNA packaging: DNA is wrapped tightly around histones and coils up like a spring into an X shaped chromosome.
B. Genome: 46 chromosomes, which code for over 30,000 (# varies with the source) genes, are found in the nucleus of all human somatic (body) cells, which contain identical copies of all the genes for that organism.

19. What is replication?
A. The process in which DNA is duplicated

20. Why does DNA need to be replicated?

21. Why does DNA need to be replicated?
B. In order to prepare for cell division (by mitosis or meiosis) – that way, there is a copy for each new cell

22. C. S phase, of interhphase
When?
C. S phase, of interhphase

23. When does DNA get replicated?
(write to the left side) Make Connections! Cell division and DNA replication
Cell division
GRR…
Growth, Repair, Replacement
When does DNA get replicated?

25. D. Steps
DNA molecules unzips
Enzyme= helicase “unzipper”
Product/How: DNA is separated

26. DNA replication
Step 2

27. DNA replication
2. Complementary Base Pairing A-T C-G
Enzyme= DNA Polymerase “matchmaker” & “proofreader”
Product/How: matches the complementary bases to the original single strands of DNA

28. DNA replication
3. Molecule is proofread for accuracy
Enzyme= Ligase “glue”
Product/How: Ligase proofreads the complementary bases and “glues” them together.

29. And the result is… E. Two identical DNA molecules have been created.
Semi-conservative= one of the original strands and one new strand.

31. FYI E. Coli- (small bacteria) Human DNA 4,639,221 base pairs
3 billion base pairs!

33. DNA Replication Prokaryotes vs. Eukaryotes
Prokaryotes Both Eukaryotes
DNA is in the cytoplasm
less DNA
Circular/loose DNA
Replication begins at a single point
Have DNA
Enzymes
DNA in the nucleus
more DNA
line or X shaped chromosomes
Replication begins at hundreds of points

34. Importance of Accuracy
Why is it soooooo important that your DNA replicates with extreme accuracy?

35. G. Errors-Mutations Sickle Cell Anemia- a point mutation
Mutations result when the DNA polymerase makes a mistake, which happens about once every 100,000,000 bases.

36. Animation!
DNA Workshop!

37. Questions for your notes
Name the building block of DNA
Draw one building block and label its 3 parts
Describe the structure of DNA (what makes up the sides and steps?), including the rules for base pairing
+ one of your own on structure

38. Questions for your notes
List the steps of DNA Replication
Why do cells need to replicate their DNA?
+ one of your own on replication
+ 2 sentence summary (how and why)

39. Practice! Show the steps of replication for this strand of DNA A T C G
G C
T A
A T