Presentation is loading. Please wait.

Presentation is loading. Please wait.

Catalyst.

Similar presentations


Presentation on theme: "Catalyst."— Presentation transcript:

1 Catalyst

2 Big Goals All students will develop, run, and present an original lab study. 100% Proficient; 90% Advanced At least 80% mastery on all EOC and college level questions At least 5 points of growth on the ACT

3 Survey

4 Announcements

5 Hook

6 SWBAT summarize the primary purpose of DNA replication
SWBAT summarize the primary purpose of DNA replication. SWBAT explain why DNA replication is considered semi-conservative. SWBAT describe the role of enzymes in DNA replication SWBAT demonstrate DNA replication by creating a complementary strand of DNA for a given DNA template.

7 I. What is DNA Replication?
-DNA Replication is when DNA makes a copy of itself. -When DNA replicates it produces two DNA molecules that are identical (exactly the same) as the original parent strand: Picture of DNA Replication: DNA Replication 1 DNA 2 DNA

8 II. Steps of DNA Replication
Step 1: Weak hydrogen bonds are broken by enzymes and DNA strands begin to unzip. Step 2: Free nucleotides join the open DNA to form 2 new DNA molecules. Step 3: There are 2 new molecules of DNA which are exact copies of each other. Each DNA molecule has one old strand and one new strand.

9 II. Steps of DNA Replication Continued
Step 3: Enzymes “zip” up the newly synthesized DNA. Step 4: There are 2 new molecules of DNA which are exact copies of each other. Each DNA molecule has one old strand and one new strand.

10 Semi-Conservative DNA replication is semi-conservative, because each new double helix contains one original strand and one new strand.

11

12 III. Why is DNA Replication Important?
-DNA Replication happens when cells divide to form two new cells. It is important that DNA replication happens because it allows each of the new cells to have DNA . -DNA Replication happens in the nucleus of a cell. -DNA Replication is important because cells need DNA to make proteins they need to survive. -DNA Replication allows a cell to pass down its genetic information to the next generation.

13 Practice with DNA Replication
-Let’s practice DNA replication! I’ll give you one strand of DNA, and you complete the complementary strand of DNA. (Remember, A=T, G=C) Original Strand: ATTAGGCTATTGACGATAGCCATGGA Complementary Strand: TAATCCGATAACTGCTATCGGTACCT

14 Practice with DNA Replication
Original Strand: GCCATAGGATTTATATGGCATAT Complementary Strand:

15 Practice with DNA Replication
Original Strand: GCCATAGGATTTATATGGCATAT Complementary Strand: CGGTATCCTAAATATACCGTATA Original Strand: CGTAATGCGGATAGTTCACGTAT Original Strand: GCTATTACGAATCGTTACGAGG


Download ppt "Catalyst."

Similar presentations


Ads by Google