1. DNA: The Secret of Life
By: James Watson
Chapter 3: Reading the Code

2. DNA: The Secret of Life Reading Reflection Chapters 3
Central Dogma of Biology
Genetic Code
Gene Expression

3. Mutations

4. Reading Reflection
Given the DNA sequence below find the mRNA sequence and the polypeptide sequence.
…. TACCCGGCGGGCCTAATACCG…
What are the possible ramifications of changing one of the bases in this sequence?
Describe the relationship between structure and function in proteins (applies to all molecules)?
Pick one researcher/group of researchers that contributed to our understanding of how DNA works…
Describe their work, what was their major discovery?, how did it help other researchers working on DNA?
(Bonus) Place the collective works of the scientists in Chapter 3 on the Nature vs. Nurture spectrum.