Download presentation
Presentation is loading. Please wait.
1
BIOBASE Training TRANSFAC® ExPlain™
Containing data on eukaryotic transcription factors, their experimentally-proven binding sites, and regulated genes ExPlain™ Combining promoter and pathway analysis to understand differential gene expression
2
Simplifies the vast biological literature space
Focuses on peer-reviewed scientific literature Experimental results are extracted by highly trained scientific curators Content is updated quarterly
3
Provides easy access to experimental data
Information extracted from the literature is organized using controlled vocabulary standards, therefore it is easily searchable Species specific, detailed curation is organized into focused reports Analysis tools provide opportunities to leverage known information for your research needs
4
TRANSFAC® and ExPlain™ advantages
View how transcription factors are known to regulate target genes Perform prediction of transcription factor binding sites Model how transcription factors act together to affect gene expression patterns Understand the cause, not just the effect, of differential gene expression in response to drug treatment, disease state, environmental stimulus and more
5
More than 2,000,000 data points
6
TRANSFAC® – TF binding site prediction
HIF-1 Experimentally verified DNA binding sites from literature Derived consensus site in form of positional weight matrix (PWM) Tools for binding site prediction on the basis of the PWMs
7
Matrix-based Binding Site Search
FP (frequency of matches in the background set ) FN (% of real sites that are not recognized ) 10 % score minFN/FN10 minSUM minFP
8
Match™ – Matrix-based TF binding site search
ttcttgaatgtaaacgtttaacaataaatcgcttgaat A 2 4 5 3 1 7 C 6 G T score s1 Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut-off, the subsequence is included as a putative binding site in the Match result.
9
Match™ – Matrix-based TF binding site search
ttcttgaatgtaaacgtttaacaataaatcgcttgaat A 2 4 5 3 1 7 C 6 G T score s2 Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut-off, the subsequence is included as a putative binding site in the Match result.
10
Match™ – Matrix-based TF binding site search
ttcttgaatgtaaacgtttaacaataaatcgcttgaat A 2 4 5 3 1 7 C 6 G T score s3 Match scans the submitted sequence with each matrix from the profile. If the matrix similarity score for a subsequence is greater than the selected cut-off, the subsequence is included as a putative binding site in the Match result.
11
Matrices included within the last year, are based on the following types of experiments:
3D structure-based energy calculations bacterial-one-hybrid system (B1H) ChIP-on-chip ChIP-Seq compiled matrix imported from literature reference compiled matrix imported from public database direct gel shift DNA-binding affinity assay DNase I footprinting matrix compiled from individual genomic sites SELEX (CASTing, SAAB, TDA, Target detection assay) universal protein binding microarrays (PBM)
12
Composite model analysis (CMA)
Find combinations of binding sites that are unique to a gene set Looks for transcriptional co-regulation
13
ExPlain™ Analysis System
Content & Application: TRANSFAC® & ExPlainTM ExPlain™ Analysis System Integrated Network and Promoter Analysis TRANSFAC® Database on transcription factors, their experimentally verified binding sites, positional weight matrices, ...
14
ExPlain™: understanding differential gene expression
+ / - Drug treatment Disease vs. normal + / - Environmental stimulus
15
Live demo TRANSFAC® Here are the details for the training server VM:
Host: Credentials for Apache Basic Authentication: Username: coh Password: coh$bio The three installed BKL builds all have users training01 - training40 (same password) set up already. I will use training01, you can use any of the remaining 39 users.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.