1. Lecture 19 – Non-tree Based Methods
Increasing molecular evidence indicates that hybridization is far more
common in animals than has traditionally been recognized. A B C D
Hybridization
Non-Introgressed Genes
Introgressed Genes
Between Sister Species
Between Non-Sister Species

2. Horizontal Gene Transfer
HGT is usually used to refer to reticulations among potentially strongly diverged organisms (i.e., large spans of evolutionary time).

3. For n taxa, there are 2(n-1) possible bipartitions.
Spectral Analysis
Examines all possible bipartitions of taxa, and examines the data for support and conflict.
A ATCGAGCAGCCTGGGAGAGAGACTTATTTGACAAACGTAA
B ATTGGGGAGTAGCGTAAACACTCTTATTTGACGAAATTAT
C ATCGTGGGTTAGAGTAGAGACTCTCATTTGACGAAATTAT
D AACGTGGCGAATAGTAGTCAAAAAATGTGTACCAGATTAC
A RYYRRRYRRYYYRRRRRRRRRRYYYRYYYRRYRRRYRYRR
B RYYRRRRRRYRRYRYRRRYRYYYYYRYYYRRYRRRRYYRY
C RYYRYRRRYYRRRRYRRRRRYYYYYRYYYRRYRRRRYYRY
D RRYRYRRYRRRYRRYRRYYRRRRRRYRYRYRYYRRRYYRY
For n taxa, there are 2(n-1) possible bipartitions.
{A} = 6 {AB} = 2
{B} = 1 {AC} = 1
{C} = 1 {AD} = 3
{D} = 12 Constant = 14

4. Spectral Analysis
Support for competing hypotheses.

5. Split Decomposition
A network-based method that incorporates reticulations into the network at points where the data have conflicting signals.
The idea is similar to Spectral Analysis in that the data are not forced into a single tree. Instead, each site is examined for the split that it supports.
Human T C C T T A A A A
Chimp T T C T A T A A A
Gorilla T T A C A A T A A
Oranutan C C A C A A A T A
Gibbon C C A C A A A A T

6. Split Decomposition This network contains two bifurcating trees Go C HGi C H Go O Gi
Orange tree has more support.

7. These can get very complicated.
Split Decomposition
These can get very complicated.
These address where the data are not tree-like, but not why.

8. Phylogenetic Networks
The idea is that different parts of the genome may be derived from different parent taxa and a network can “contain” several gene trees.
Several gene trees
Infer the network with fewest
reticulations.

9. Phylogenetic Networks
Wu et al. (2012. PLoS Genetics) provided the likelihoods for gene trees evolving within a
phylogenetic network from multispecies coalescent.
Of course, adding reticulations will always improve the likelihood score, so some type of model selection is required.

10. Phylogenetic Networks
PhyloNET includes a Bayesian implementation.
Zhu et al. (2018)
With number of reticulations set to 1, the multispecies coalescent allows for
inference of the species network.
Lambda (blue) represents the fraction of the genome derived from each parent
across a reticulation.

11. Phylogenetic Networks
More complicated histories (e.g., Morales-Biones et al. 2018).
ASTRAL
SVDQuartets

12. Phylogenetic Networks
More complicated histories (e.g., Morales-Biones et al. 2018).
Species network – two ancient hybridization events.

13. Quartet Methods for Detecting Hybridization
ABBA – BABA tests
Is the presence of shared alleles due to ILS or hybridization?
The original versions of these tests required a species-tree estimate.
Under ILS, there should be no asymmetry in ABBA versus BABA frequencies.

14. Quartet Methods for Detecting Hybridization
(16)
Estimation of Species Tree and Simultaneous
Inference of Hybridization
SVDQuartets & HyDe
40% of species
are involved in
introgression,
sometimes with
multiple partners.

15. Quartet Methods for Detecting Hybridization
quadrivittatus group
Free-love zone
for mtDNA
Sullivan et al. (2014)

16. Quartet Methods for Detecting Hybridization
T. quadrivittatus Species Group

17. T. quadrivittatus group mtDNA gene tree
231 individual
Cyt b sequences
T. quadrivittatus group mtDNA gene tree
Clade D – quadrivittatus
plus one dorsalis
Clade C – umbrinus & quadrivittatus
Front Range plus dorsalis
E. Flaming Gorge
a.k.a WTF?-1
T. dorsalis – Sky Islands
Clade B – T. rufus
cinereicollis & dorsalis
cinereicollis
& dorsalis
Clade A – T. canipes
Clade WTF?-2
New Mexico
umbrinus & dorsalis

18. mtDNA Genome Tree Clade WTF-2 (New Mexico)
1.0
Clade WTF-2 (New Mexico)
T. cinereicollis & T. dorsalis
T. umbrinus & T. dorsalis
T. dorsalis – Sky Islands
Clade D – T. quadrivittatus
plus one T. dorsalis
Clade C, a.k.a WTF-1 (Front Range)
Clade A – T. canipes
Clade B – T. rufus

19. Exploration of Nuclear Introgression using Admixture
111,441 SNPs
T. dorsalis exhibits heterogeneity, but no co-ancestry with other taxa.
T. canipes
T. cinereicollis
T. dorsalis
T. quadrivittatus
T. rufus
T. umbrinus

20. T. quadrivittatus group phylogenomics
T. dorsalis
T. canipes
T. rufus
T. cinereicollis
T. umbrinus
T. quadrivittatus
Species-tree Estimation Approaches are Congruent.
T. dorsalis
T. striatus
T. canipes
T. cinereicollis
T. quadrivittatus
T. rufus
T. umbrinus
SVDquartets

21. Quartets Analysis of Introgression
Chiffman & Kubatko (2014)
Tst
Tum
Td-i
Td-ni
Species tree
mtDNA tree
No evidence of nuclear introgression in spite of nearly identical mito genomes.