1. Process Measurements Division Surface Immobilization of Biopolymers Patent #5,942,397 Issued Aug. 24, 1999 Inventors: Michael J. Tarlov, Tonya M. Herne, Keith H. McKenney National Institute of Standards and Technology Gaithersburg, MD 20899

2. What is it? A method for forming a biopolymer-containing monolayer…and organic thiol Biopolymer" refers to any oligonucleotide, polypeptide, polysaccharide, and derivatives thereof.

3. The 2-Step Method: DNA Monolayers on Gold Au Probe Self-Assembly HS - (CH 2 ) 6 - ss-DNA 53 Au Substrate Passivation HS - (CH 2 ) 6 - OH = Au Hybridization Control DNA probe coverage by varying probe assembly time Passivation step activates DNA probes for hybridization & passivates surface

4. What Its Good For: Fabrication of Nucleic Arrays Microarrays or Biological Sensors/Diagnostics Applications: Gene expression profiling Genetic disease screening Infectious disease monitoring Cancer treatment Drug development DNA nanoparticle based sensors: 100 nm DNA microarrays:

5. Advantages over other monolayer systems and monolayer formation methods Au-thiol chemistry happens: excellent reproducibility compared to organosilane monolayers or other covalent coupling schemes Au-thiol monolayers can be patterned with micrometer resolution to fabricate arrays of biological ligands for high through-put screening applications Gold (Ag, Pt, Pd, Ru, Ir & alloys) is good substrate: inert & amenable to detection via surface plasmon resonance, electrochemical, enhanced-fluorescence, & other methods

6. Invention Status Patent issued Aug. 99 Reduced to practice with DNA System/method extensively studied/used by us & others: 1.T. M. Herne, et al. JACS, 1997 2.R. Levicky, et al. JACS, 1998 3.A. B. Steele, et al. Anal. Chem., 1998 4.A. B. Steele, et al. Biophysical Journal, 2000 Invention Scope Restricted solely to nucleic acids or are polypeptides and polysaccharides also covered???

8. DNA Concentration Profile Determined by Neutron Reflectivity R. Levicky, et al. JACS 120 (1998) 9787 TE Buffer, 1 M NaCl Au 8.0 nm DNA adsorption Add mercaptohexanol Hybridize

9. Binding Energy (eV) Intensity (Arb. Units) XPS Evidence for End-Tethering of HS-DNA T. M. Herne, et al. JACS 119 (1997) 8916 410405400395390 N 1s HS-ssDNA

10. Sample preparation: Thin film Au on Si or glass substrates Incubate in buffered 1 micro-molar DNA or HS-DNA Rinse with water aqueous buffer SH H 2 O rinse, dry S SS S S S 10 12 -10 14 oligos/cm 2 1 - 10 nm between strands Characterization Techniques: Electrochemical Neutron Reflection Surface Plasmon Resonance Radiolabeling Ellipsometry SIMS NEXAFS XPS FTIR Model System: Thiol-Derivatized DNA on Gold Thiol attachment to Au is stable and well-characterized Au surfaces are amenable to surface characterization CACGACGTTGTAAAACGACGGCCAG 3 5 HS(CH 2 ) 6 PO 4 Synthetic Thiol-Derivatized Oligonucleotides: Each homo-oligo (A, T, C, or G) gives unique spectral fingerprint Frequency shifts indicate flat vs. upright orientation N (1s): DNA presence & coverage N (1s) shifts: flat vs upright orientation

11. DNA: A Programmable Nanoscale Assembly Material? Attractive Nanomaterial Properties of DNA: –Molecular zip code for linking & directing placement of nanoscale objects –Synthetic versatility: vary length, sequence, backbone, branched, dendrimers –Easily modified for conjugation to molecules, nanoparticles, surfaces J. D. Le, et al. Nanolett. 119 (2005) 2343. Nanostructures made of DNA Mirkin, Inorg. Chem. 39 (2000) 2258. DNA-linked nanoparticles 100 nm S. A. Claridge, et al. Chem. Mater. 17 (2005) 1628. DNA Programmed-Assembly Review: Gothelf, LaBean Org. Biomol. Chem. 3 (2005) 2043. Zheng, et al. Science 302 (2003) 1545. DNA-wrapped CNTs DNA-Based Nanoarchitectures and Nanomachines, Org. Biomol. Chem. 4(18), Sept. 21, 2006

12. DNA Microarrays Synthetic ss-DNA Probes 1-100 m Applications: Gene expression profiling Genetic disease screening Infectious disease monitoring Cancer treatment Drug design Affymetrix GeneChip microarray Hybridized Target-Probe Labeled ss- DNAtargets