Download presentation
Presentation is loading. Please wait.
1
Mutations Changes to DNA
2
Mutations permanent change in a cell’s DNA sequence
Includes changes in nucleotide sequence, alteration of gene position, gene loss, duplication, or insertion of foreign sequences Can be inherited if mutation is in gamete Most mutations have a negative effect Positive mutation? evolution
3
Mutagen Any agent that causes changes in DNA
Includes physical agents that damage DNA X-rays UV rays Cigarette tar Gamma rays carcinogens
4
Mutant An organism carrying a gene that has mutated
5
Mutations Changes to DNA are called mutations change the DNA
changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait
6
Classes of Mutations Gene level Chromosome level
Mutations include different point & frame-shift mutations Chromosome level Rearrangement of genes within or between chromosomes
7
Gene Level Mutations Changes to the letters (A,C,T,G bases) in the DNA
point mutation change to ONE letter (base) in the DNA may cause change to protein, may not frameshift mutation addition of a new letter (base) in the DNA sequence deletion of a letter (base) in the DNA both of these shift the DNA so it changes how the codons are read big changes to protein!
8
Does this change the sentence?
Point Mutations One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN
9
Does this change the protein?
Point Mutations Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
10
Misshapen sickle cells
Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids
11
The code has repeats in it! Does this change the protein?
Point Mutations Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
12
Really destroyed that protein!
Point Mutations Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop
13
Does this change the sentence?
Frameshift Mutations Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN
14
Does this change the protein?
Frameshift Mutations Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
15
Does this change the protein?
Frameshift Mutations Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
16
Cystic fibrosis Broken salt channel in cells
strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.
17
mucus & bacteria build up = lung infections & damage
Salt channel transports salt through protein channel out of cell Osmosis problems! Effect on Lungs normal lungs airway salt salt channel normal mucus H2O cells lining lungs cystic fibrosis salt thick mucus In people without cystic fibrosis, working cystic fibrosis proteins allow salt (chloride) to enter the air space and water follows by osmosis. The mucus layer is dilute and not very sticky. In people with cystic fibrosis, non-working cystic fibrosis proteins mean no salt (chloride) enters the air space and water doesn't either. The mucus layer is concentrated and very sticky. People with cystic fibrosis have lung problems because: Proteins for diffusion of salt into the airways don't work. (less diffusion) Less salt in the airways means less water in the airways. (less osmosis) Less water in the airways means mucus layer is very sticky (viscous). Sticky mucus cannot be easily moved to clear particles from the lungs. Sticky mucus traps bacteria and causes more lung infections. Therefore, because of less diffusion of salt and less osmosis of water, people with cystic fibrosis have too much sticky mucus in the airways of their lungs and get lots of lung infections. Thus, they are sick a lot. H2O mucus & bacteria build up = lung infections & damage
18
Deletion leads to Cystic fibrosis
Loss of one amino acid!
19
Chromosome Level Mutations
Mutation involving a large segment of DNA Translocation Inversion Deletions
20
Chromosome Level Mutations
Translocation Relocation of groups of base pairs from 1 chromosomes to another (usually occurs between homologous chromosomes) New proteins can result Eg. Some types of leukemia Transposable element – fragments of DNA that continue to move from 1 chromosomes to another (can disrupt transcription
21
Chromosome Level Mutations
Translocation Inversion A sequence of DNA is inverted (reversed) ABC → CBA Can disrupt base pairing Deletions
22
Chromosome Level Mutations
Translocation Inversion Deletions Involve loss of chromosomal material Eg. Cancer – results of mutation in genetic sequence
23
Not to ask questions is a mutation!
Similar presentations
