Download presentation
Presentation is loading. Please wait.
Published byMargaretMargaret Scott Modified over 5 years ago
1
Gene transfer to plants – vectors and strategies
Bio4600
2
Methods of transformation:
Particle bombardment: Small particles covered with DNA are introduced into plant cells Whole plants are regenerated from transformed cells by tissue culture
3
Particle bombardment:
Integration of many and often rearranged copies of foreign DNA in replicating regions
4
Methods of transformation:
Agrobacterium tumefaciens-mediated transformation Utilization of a natural gene transfer system Introduction in flowering plants or plant cells Dicotyledonous plants
5
A. tumefaciens transformation of plant cells
Ti-plasmid with T-DNA transfer of single-stranded T-DNA random integration
6
Selection of transformants and generation of transfomed plants
7
General requirements to a T-DNA vector
pVS1 Sm/SpR LB pnos nptII 3’nos RB pKOH110- (10813bp +) EcoRI SmaI XbaI SscSJ87I HindIII Right and Left Borders E. coli origo A. tumefaciens origo Bacterial selectable marker Plant selectable marker Cloning sites Plasmid with vir-genes in A. tumefaciens strain
8
Vector for promoter analysis
SmaI BamHI XbaI SalI PstI HindIII CCCGGGGATCCTCTAGAGTCGACCTGCAGGCTGCAAGCTT nos- ter gus nptII LB StrR, SmR RB pZP221G Vector backbone bp ori pVS1 pBR322 bom rep NheI ClaI
9
Vector for over-expression and GFP detection
PstI SmaI BamHI NotI XhoI EcoRI CmR ccdB BglII XbaI EcoRI attR1 PstI TL 35S GAW-A GFP ter attR2 EcoRI XbaI SscSJ87I HindIII RB pnos nptII pKOH35SGAWGFP 3’nos (ca. 14 kb) pVS1 LB Sm/SpR TL - translasjonsenhancer ter -terminator
10
Vector for knock-down, RNAi
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.