1. Figure 1a. Insertion of sequence into Claudi capsid gene
Domain 1, HK97-Like Capsid Fold
Domain 2, Probability: 69.8, E-value: 9.2E-4 Bacterial Ig-like domain, group 2
KongoTrouble
Phamerator map image of Claudi capsid protein (gene 31) region compared to KongoTrouble (gene 27). Claudi capsid is missing its Big2 domain (dotted line) due to insertion of sequence into the capsid gene. Domain labels are from HHPred.
Claudi

2. Fig 1b. Insertion of sequence into Claudi capsid gene
KT: 14053
KT: 14054
232 bp INSERTION
TTAATATAA
C: 14362
C: 14594
Insertion in Claudi capsid gene. Alignment of KongoTrouble and Claudi capsid gene sequences shows a 6-nucleotide repeat (AAAAGG) is present on either side of the inserted nucleotide sequence. The insertion includes a stop codon (in red) that allows translation to stop after completion of the HK97-like domain. Coding potential from Genemark is shown below each domain, showing the Big2 domain has high coding potential but no start codon.

3. Fig 1c. Alignment of insertion sequence
97% identity to Bacillus Prophage
Insertion, 232 bp
Claudi
gp 31
ATTGAAATGACAAATGTTTACAATCCAAAAGGTTAATATAA
gp 32
AAAAGGT- - ATACTGGAATTACTTCTA
KongoTrouble
ATTGAAATGACAAATGTTTACAATCCAAAAGGTCTATACTGGAACTACTTCTA
gp 27
Potential mechanism of recombination for Claudi capsid gene. Sequence alignment includes alignment of the 6-nucleotide repeat sequence into a structure that might be recognized by a recombination enzyme.

4. Fig 2a. Insertion of gene into SerPounce genome
Gene 44 has been inserted into SerPounce’s genome
Blasting SerPounce against itself has shown a 77 bp repeat on either side of the gene
Possible insertion mechanism
Purple shading is due to the first insertion in SerPounce being identical to the a sequence in KongoTrouble
Orange shading shows a near to identical match of the second repeat with the same sequence in KongoTrouble
KongoTrouble
SerPounce

5. Fig 2b. Insertion of gene into SerPounce genome
Gene 44, 30% Identity with Listeria Phage
Insertion
SerPounce
77 bp repeat
Gene 43
ATCCCCTTTATGATTGTTTTAGTTGTTTTCTTAACCTATAATTATTATATCATTTATGTGTTAAATCGTCAATAGAT
KongoTrouble
ATCCCCTTT-TG-TTGTTTTAGTTGTTTT-TTAACCTATAATTATTATAACATTTATGTGTTAAATCGTCAATAGAT
Gene 40
ATCCCCTTTATGATTGTTTTAGTTGTTTTCTTAACCTATAATTATTATATCATTTATGTGTTAAATCGTCAATAGAT
Visualization of SerPounce Gene 44 Insertion
This protein isn’t in any other phage in the database. SerPounce gp44 doesn’t have Bacillus or Bacillus phage homologs. Best matches are to Listeria phage protein.

6. Missing second (incomplete) domain
Has complete domain
Sequence used, Claudi gene 31 and space till gene 32 (query) compared to ViolettaMad gene 16 (subject)
Claudi is on top in blue and Violettamad is on the bottom in red
Red bar show the similar sequence between the two genomes
Above we see a that there was an insertion in the Claudi gene 31, creating a break in the red bar. The rest of the original gene is downstream show again in red.

7. Note, difference in protein sequence highlighted in orange.
Claudi capsid protein has a missing domain, as seen when compared to the VIolettaMad above.

8. Panel B Insertion Mechanism Draft
Gap sequence completely found in Claudi and SerPounce Genome
Rest of hits are in Bacillus family
How is this a mechanism? Ask Allison
Claudi Gap results in blastn with repeats has a lot of hits look at pdf on wiki

9. Panel C Draft
Sequence used, Claudi gene 31 and space till gene 32 (query) compared to KongoTrouble gene 27 (subject)
Claudi is on top in blue and KongoTrouble is on the bottom in red
Red bar show the similar sequence between the two genomes
Above we see a that there was an insertion in the Claudi gene 31, creating a break in the red bar. The rest of the original gene is downstream show again in red.
Results for blasting Claudi gap against
KongoTrouble gene
Complete gene domain is only found in the podoviruses (phamerator)

10. Panel D
Someone is making an image or something here.