1. Novel Type I Hair Keratins K39 and K40 Are the Last to be Expressed in Differentiation of the Hair: Completion of the Human Hair Keratin Catalog 
Lutz Langbein, Michael A. Rogers, Silke Praetzel-Wunder, Dittmar Böckler, Peter Schirmacher, Jürgen Schweizer 
Journal of Investigative Dermatology 
Volume 127, Issue 6, Pages (June 2007)
DOI: /sj.jid
Copyright © 2007 The Society for Investigative Dermatology, Inc Terms and Conditions

2. Figure 1
Schematic physical map of human type I hair keratin gene regions and evolutionary tree analysis of human type I hair keratins. (a) Main hair keratin gene cluster (functional genes, light gray boxes; pseudogenes, white boxes) and the subcluster of two new hair keratin genes KRT39 and KRT40 (black boxes). Both subclusters are separated by a domain of 33 KAP genes (checked boxes). The flanking epithelial keratin genes are given as dark gray boxes. Compared with the scheme of Rogers et al. (2004), this scheme does not reflect authentic intergenic distances. (b) Evolutionary tree of human type I hair keratins (data are based on Rogers et al., 2004). Also indicated are the respective expression sites of keratins. (b) Hitherto-used keratin designations are in parentheses.
Journal of Investigative Dermatology  , DOI: ( /sj.jid )
Copyright © 2007 The Society for Investigative Dermatology, Inc Terms and Conditions

3. Figure 2
K39 and K40 mRNA (ISH) and protein expression (IIF) in the hair follicle. (a–c) K39: Both (a) mRNA and (b) protein are detectable in the upper hair cortex (co) and cuticle (cu). The inset in (b) shows a higher magnification of the follicle. K39 is also visible in the upper medulla (med, open red arrow in panel b). (c) Colocalization of K39 and the cuticular hair keratin K32 (formerly Ha2) in the upper cuticle is seen by the yellow (merged) staining. (d–f) K40: This keratin is restricted to the upper hair cuticle alone (d: ISH; e: IIF). (f) Local coexpression of K40 with the cuticular hair keratin K32 is seen by the yellow (merged) staining. (b and e) Zones of the mRNA synthesis are marked by red arrows. Throughout, the staining on beard (a–f) or scalp hairs was essentially comparable. Tissues were obtained during surgery for medical reasons (Department of Vascular and Endovascular Surgery, University of Heidelberg) or from cadavers for pathological investigations (Institute of Pathology, University of Heidelberg) under institutional approval and included adherence to the Declaration of Helsinki Principles. For ISH, PCR fragments of the 3′-non-coding regions were amplified using the following oligonucleotides and PCR conditions. K39: 202bp; primers: agacctgccaaagtctaacatc and tgttagcagtggtgagttaggg; K40: 180bp; primers: aatcaaagccagcagcatccta and gctttatgggcttccagtats. PCR annealing temperature 53°C. ISH probes were generated by in vitro transcription. For IIF, antisera were produced by injection of synthetic peptides into guinea-pigs: K39: DKTGCTTTNSPSTP (amino-acid position: 2–14; serum dilution 1:500); K40: LPCYFTGSCNSPC (amino-acid position: 60–72; dilution 1:2,000) (peptide synthesis/coupling by Peptide Specialty Laboratories, Heidelberg, Germany). Antisera were carefully checked for specificity and possible crossreactivity on numerous types of epithelial and non-epithelial tissues. ISH signals were recorded by simultaneous visualization of epi-illumination (ISH) for the detection of reflection signals and transmitted light in bright field for hematoxylin staining (for technical details, see Langbein et al., 2004). Nuclear counterstaining by 4′,6-diamidino-2-phenylindole is given in blue. dp, dermal papilla. Bars=150μm. (g and h) Schematic presentation of mRNA expression patterns of human type I and type II hair keratins in the hair-forming compartment. (g) Zones of mRNA synthesis. In the hair cuticle, six keratins (four type I+two type II) are sequentially expressed, with K39 and K40 being the latest keratins in this compartment. The hair matrix/cortex region contains 11 keratins (seven type I+four type II) or 13 keratins (9 type I+4 type II) if the heterogeneous cortical expression of K38 and the expression of K37 in the central cortex of vellus hairs are included. The ratios indicate the number of type I and type II keratins at different levels of the hair-forming compartment. The hitherto-used keratin designations are given in parentheses. (h) Start of mRNA synthesis of human type I and II hair keratins. The onset of mRNA expression of individual hair keratins in various compartments of the follicle is indicated by their names. The size of the designations reflects the intensity of expression. *K38, heterogeneous expression; **K37, expression only in vellus hair cortex and sexual hair medulla.
Journal of Investigative Dermatology  , DOI: ( /sj.jid )
Copyright © 2007 The Society for Investigative Dermatology, Inc Terms and Conditions