Presentation is loading. Please wait.

Presentation is loading. Please wait.

David W. Bauer1, PhD Nasir Butt2, PhD Jeffrey Oblock2

Published byClementina Colucci Modified over 5 years ago

Similar presentations

Presentation on theme: "David W. Bauer1, PhD Nasir Butt2, PhD Jeffrey Oblock2"— Presentation transcript:

1 Developing investigative leads from a probabilistic genotyping database
David W. Bauer1, PhD Nasir Butt2, PhD Jeffrey Oblock2 Mark W. Perlin1, PhD, MD, PhD  1Cybergenetics Pittsburgh, PA  2Cuyahoga County Forensic Laboratory Cleveland, OH Cybergenetics ©

2 DNA evidence chain • DNA can provide identification information
• DNA data requires interpretation Genotype • Link culprit to crime scene ATCGACTGATCGACGAGAACTACGATAGAGAC DATA

3 A broken link • Manual methods simplify the data
• DNA identification information lost Allele List • Minimal connection back to culprit ATCGACTGATCGACGAGAACTACGATAGAGAC Human interpretation DATA

4 Probabilistic Genotyping
• TrueAlleleTM probabilistic genotyping • Uses all of the data • Preserves ID information Genotype • Connect culprit to crime scene ATCGACTGATCGACGAGAACTACGATAGAGAC DATA

5 Investigative TrueAllele Database
Create leads for criminal investigations evidence • Link suspect to evidence within cases suspect • Link suspects to other cases evidence suspect • Link evidence between crime scenes evidence

6 STR genotype Cell locus DNA Mother allele Father allele ACGT 1 2 3 4 5
6 7 8 9 Father allele 1 2 3 4 5 6 7 8 9 10 11 12

7 STR data Task: to infer genotypes from peaks Data focuses probability
before after 9 Single source … 12 … 9, 9 3% 9, 9 9, 10 6% 9, 10 9, 11 3% 9, 11 RFU 9, 12 4% 9, 12 100% 10, 10 2% 10, 10 10, 11 5% 10, 11 10, 12 3% 11 10, 12 8 … … Size (bp)

8 STR mixture data more complexity more uncertainty less focused
probability 9 No single answer 2 person mixture 7 8 … 7, 7 40% 7, 8 2% RFU 7, 9 3% 8, 8 35% 8, 9 5% 9, 9 15% Size (bp) …

9 Cleveland auto thefts • Spike in auto thefts during summer/fall 2015
• Gang involvement suspected 37 cases • 161 DNA evidence samples • 72 references samples

10 The challenges: Throughput
161 evidence samples 72 references ~12,000 comparisons X = 12,000 comparisons 10 minutes per comparison X = > 2,000 human-hours • A lot of human time performing repetitive task

11 The challenges: Data complexity
Reported conclusions: “…complexity of the data…” “…mixture of at least 3 individuals…” “…therefore, no further conclusions can be drawn.” 11 13 9 12 RFU 10 8 Size (bp)

12 Interpreting complex data
- TrueAllele computer proposes possibilities - Compares with data to calculate probability - Good explanations higher probability 11 13 9 12 minor major RFU middle 10 8 Size (bp)

13 Uncertainty ≠ Uninformative
• TrueAllele separates out genotypes from data Evidence genotype for major contributor Probability 9,11 10,11 9,12 10,12 11,12 9,13 10,13 11,13 12,13 Allele pair

14 Uncertainty ≠ Uninformative
• TrueAllele separates out genotypes from data Evidence genotype for major contributor Probability Allele pair frequency from population 9,11 10,11 9,12 10,12 11,12 9,13 10,13 11,13 12,13 Allele pair

15 Uncertainty ≠ Uninformative
• Use genotypes to calculate match statistics Prob(evidence match) Prob(coincidental match) Likelihood ratio (LR) = Probability 7x 14% 2% 9,11 10,11 9,12 10,12 11,12 9,13 10,13 11,13 12,13 Allele pair

16 Uncertainty ≠ Uninformative
• Allele lists loose identification information Allele list 9, 10, 11, 12, 13 1/CPI 1.14 Probability 7x 3.24, 5.92, 29.7, 34.4, 20.6 14% 2% 9,11 10,11 9,12 10,12 11,12 9,13 10,13 11,13 12,13 Allele pair

17 Linking suspects to crimes
161 items 72 references 127 ref-evi matches 1,200 comparisons 37 References 31 Cases

18 The missing links TrueAllele Database Manual & T.A. (59 case-ref)
37 References 31 Cases

19 Method comparison Manual review TrueAllele IPGD ~2 months from data
to interpretations Few hours of analyst time 23 references 37 references At least one reference association for all 30 30 items ‘inconclusive’ 12 reported exclusions 12 positive associations

20 Match review Search Download
_ncon3_100K _ref

21 Match review • Quick and easy access to data, genotypes, match statistics _ncon3_100K _ref

22 Match rarity • Quantify specificity • Calculated for each genotype
Mean log(LR) = -7.5 • Quantify specificity Std dev = 3.13 • Calculated for each genotype For a match strength of 95.2 billion only one in 74.7 trillion people would match as strongly.

23 Connecting crime scenes
• Use all the data • Investigative leads between cases • Database calculates match statistics between evidence items

24 Evidence in action • July & August 2013 in Bakersfield, CA
• Three separate break-ins and sexual assault cases

25 Evidence in action • 37 swabs and cuttings Pants
• Low level DNA mixtures • Evidence matches between cases • CODIS hit on zip tie Phone cord Zip tie in road Phone Bathtub handle

26 Evidence in action • 37 swabs and cuttings • Low level DNA mixtures
• Evidence matches between cases • CODIS hit on zip tie • Arrest (2013) and conviction (2015) Zip tie in road

27 World Trade Center Powerful TrueAllele Database to identify victim remains Kinship profile TrueAllele database ~18,000 victim remains samples ~6,500 family references ~2,400 personal effects ~2,700 people

28 Conclusions • Automate DNA investigation
• Reduce interpretation bottleneck • Extract more information from DNA data • Match suspects to crimes • Connect crime scenes together

29 More information www.cybgen.com • Courses • Newsletters • Newsroom
• Presentations • Publications • Webinars TrueAllele YouTube channel:

Download ppt "David W. Bauer1, PhD Nasir Butt2, PhD Jeffrey Oblock2"

Similar presentations

Overcoming DNA Stochastic Effects 2010 NEAFS & NEDIAI Meeting November, 2010 Manchester, VT Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA Cybergenetics.

Overcoming DNA Stochastic Effects 2010 NEAFS & NEDIAI Meeting November, 2010 Manchester, VT Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA Cybergenetics.
Forensic DNA Inference ICFIS 2008 Lausanne, Switzerland Mark W Perlin, PhD, MD, PhD Joseph B Kadane, PhD Robin W Cotton, PhD Cybergenetics © 2003-2008.

Forensic DNA Inference ICFIS 2008 Lausanne, Switzerland Mark W Perlin, PhD, MD, PhD Joseph B Kadane, PhD Robin W Cotton, PhD Cybergenetics ©
DNA Mixture Interpretations and Statistics – To Include or Exclude Cybergenetics © 2003-2013 Prescription for Criminal Justice Forensics ABA Criminal Justice.

DNA Mixture Interpretations and Statistics – To Include or Exclude Cybergenetics © Prescription for Criminal Justice Forensics ABA Criminal Justice.
Finding Truth in DNA Mixture Evidence Innocence Network Conference April, 2013 Charlotte, NC Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA.

Finding Truth in DNA Mixture Evidence Innocence Network Conference April, 2013 Charlotte, NC Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA.
How Inclusion Interpretation of DNA Mixture Evidence Reduces Identification Information American Academy of Forensic Sciences February, 2013 Washington,

How Inclusion Interpretation of DNA Mixture Evidence Reduces Identification Information American Academy of Forensic Sciences February, 2013 Washington,
Creating informative DNA libraries using computer reinterpretation of existing data Northeastern Association of Forensic Scientists November, 2011 Newport,

Creating informative DNA libraries using computer reinterpretation of existing data Northeastern Association of Forensic Scientists November, 2011 Newport,
How TrueAllele ® Works (Part 3) Kinship, Paternity and Missing Persons Cybergenetics Webinar December, 2014 Mark W Perlin, PhD, MD, PhD Cybergenetics,

How TrueAllele ® Works (Part 3) Kinship, Paternity and Missing Persons Cybergenetics Webinar December, 2014 Mark W Perlin, PhD, MD, PhD Cybergenetics,
Preventing rape in the military through effective DNA computing Forensics Europe Expo Forensics Seminar Theatre April, 2014 London, UK Mark W Perlin, PhD,

Preventing rape in the military through effective DNA computing Forensics Europe Expo Forensics Seminar Theatre April, 2014 London, UK Mark W Perlin, PhD,
TrueAllele ® Casework Validation on PowerPlex ® 21 Mixture Data Australian and New Zealand Forensic Science Society September, 2014 Adelaide, South Australia.

TrueAllele ® Casework Validation on PowerPlex ® 21 Mixture Data Australian and New Zealand Forensic Science Society September, 2014 Adelaide, South Australia.
Using TrueAllele ® Casework to Separate DNA Mixtures of Relatives California Association of Criminalists October, 2014 San Francisco, CA Jennifer Hornyak,

Using TrueAllele ® Casework to Separate DNA Mixtures of Relatives California Association of Criminalists October, 2014 San Francisco, CA Jennifer Hornyak,
No DNA Left Behind: When inconclusive really means informative Schenectady County District Attorney’s Office January, 2014 Mark W Perlin, PhD, MD,

No DNA Left Behind: When "inconclusive" really means "informative" Schenectady County District Attorney’s Office January, 2014 Mark W Perlin, PhD, MD,
Revolutionising DNA analysis in major crime investigations The Investigator Conferences Green Park Conference Centre May, 2014 Aylesbury, Buckinghamshire.

Revolutionising DNA analysis in major crime investigations The Investigator Conferences Green Park Conference Centre May, 2014 Aylesbury, Buckinghamshire.
Computer Interpretation of Uncertain DNA Evidence National Institute of Justice Computer v. Human June, 2011 Arlington, VA Mark W Perlin, PhD, MD, PhD.

Computer Interpretation of Uncertain DNA Evidence National Institute of Justice Computer v. Human June, 2011 Arlington, VA Mark W Perlin, PhD, MD, PhD.
How TrueAllele ® Works (Part 2) Degraded DNA and Allele Dropout Cybergenetics Webinar November, 2014 Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh,

How TrueAllele ® Works (Part 2) Degraded DNA and Allele Dropout Cybergenetics Webinar November, 2014 Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh,
TrueAllele ® Genetic Calculator: Implementation in the NYSP Crime Laboratory NYS DNA Subcommittee May 19, 2010 Barry Duceman, Ph.D New York State Police.

TrueAllele ® Genetic Calculator: Implementation in the NYSP Crime Laboratory NYS DNA Subcommittee May 19, 2010 Barry Duceman, Ph.D New York State Police.
Separating Familial Mixtures, One Genotype at a Time Northeastern Association of Forensic Scientists November, 2014 Hershey, PA Ria David, PhD, Martin.

Separating Familial Mixtures, One Genotype at a Time Northeastern Association of Forensic Scientists November, 2014 Hershey, PA Ria David, PhD, Martin.
Cybergenetics Webinar January, 2015 Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA Cybergenetics © 2003-2015 How TrueAllele ® Works (Part 4)

Cybergenetics Webinar January, 2015 Mark W Perlin, PhD, MD, PhD Cybergenetics, Pittsburgh, PA Cybergenetics © How TrueAllele ® Works (Part 4)
Cracking the DNA mixture code – computer analysis of UK crime cases Forensics Europe Expo Forensic Innovation Conference April, 2014 London, UK Mark W.

Cracking the DNA mixture code – computer analysis of UK crime cases Forensics Europe Expo Forensic Innovation Conference April, 2014 London, UK Mark W.
Unleashing Forensic DNA through Computer Intelligence Forensics Europe Expo Forensic Innovation Conference April, 2013 London, UK Mark W Perlin, PhD, MD,

Unleashing Forensic DNA through Computer Intelligence Forensics Europe Expo Forensic Innovation Conference April, 2013 London, UK Mark W Perlin, PhD, MD,
Rapid DNA Response: On the Wings of TrueAllele Mid-Atlantic Association of Forensic Scientists May, 2015 Cambridge, Maryland Martin Bowkley, Matthew Legler,

Rapid DNA Response: On the Wings of TrueAllele Mid-Atlantic Association of Forensic Scientists May, 2015 Cambridge, Maryland Martin Bowkley, Matthew Legler,

Similar presentations

Ads by Google