1. Y chromosome analysis of infertile men and their sons conceived through intracytoplasmic sperm injection: vertical transmission of deletions and rarity of de novo deletions 
David S Cram, Ph.D., Kun Ma, Ph.D., Shalender Bhasin, M.D., Jose Ariasc, Marintan Pandjaitanc, Brendan Chu, M.S.bPam Audrins, B.A., Doug Saunders, M.D., Frank Quinn, M.D., David deKretser, M.D., Robert McLachlan 
Fertility and Sterility 
Volume 74, Issue 5, Pages (November 2000)
DOI: /S (00)

2. Figure 1
Map of the Y chromosome and relevant genetic markers. Yq deletions in two father/son pairs (F = father; S = son) are mapped relative to a fertile male control. The position of STS and gene markers that were used in the study are indicated. Map locations of AZFa, AZFb, AZFd, and AZFc have been previously defined (7, 14). Solid black boxes represent the presence of an STS/gene, and open boxes represent the indicated deletion interval, as defined by the absence of contiguous STS/gene markers. Gray boxes indicate regions that were not tested but were assumed to be present because they were juxtaposed between confirmed positive STS/genes. The junction of the euchromatic and heterochromatic Yq regions is denoted by E/H.
Cram. Y chromosome analysis of infertile men. Fertil Steril 2000.
Fertility and Sterility  , DOI: ( /S (00) )

3. Figure 2
Molecular analysis of Yq deletions in two ICSI father/son pairs. The results of five STSs (sY153, sY152, sY247, sY158, and sY159) and five genes (BPY1, XKRY, RBM1, BPY2, and DAZ), as well as two control genes (SRY and GAPDH) are shown as an example. Markers on each DNA sample were amplified in singleplex PCR reactions, and products were combined for the AZFa-b, AZFd, and AZFc regions before analysis by agarose gel electrophoresis in individual lanes. Gene-specific primer sequences were as follows: RBM1, 5′ ATGCACTTCAGAGATACGG 3′ and 5′ AGTAACTCTCCCAACTTCTGC 3′; BPY1, 5′ AAGGGGCTGCGACAAAGATGG 3′ and 5′ TGTCATCAACATGGGAAGCAC 3′; XKRY, 5′ CACTCATGGAGAAGGGTAGG 3′ and 5′ GTCACACTCAGCCTCTTTAC 3′; BPY2, 5′ CTAATTCCCTCTTTACGCATGACC 3′ and 5′ GCCATATCTCTGAGCACATAACC 3′; GAPDH (chromosome 12), 5′ ATCACTGCCACCCAGAAGACT 3′ and 5′ CATGCCAGTGAGCTTCCCGTT 3′; DAZ, 5′ GGGTGTTACCAGAAGGCAAA 3′ and 5′ GAACCGTATCTACCAAAGCAGC 3′. Primers for STS markers sY153, sY152, sY247, sY158, sY159, and the SRY gene have been described previously (3, 7).
Cram. Y chromosome analysis of infertile men. Fertil Steril 2000.
Fertility and Sterility  , DOI: ( /S (00) )

4. Figure 3
Southern blot hybridization analysis of Yq deletions. (A), Ethidium bromide–stained gel of EcoRI-digested genomic DNA from fathers who underwent ICSI and their ICSI-conceived sons with PCR-indicated deletions (F/S 530 and F/S 749), with no PCR-indicated deletions (F/S 1400), and a fertile male control. Molecular weight markers in kilobases (kb) are shown at the right. (B), Autoradiograph of the Southern blot probed with a 32P-labeled 713 base-pair DAZ gene fragment (GenBank accession AC000021, position ) showing the presence or absence of the 2.8-kb EcoRI DAZ band.
Cram. Y chromosome analysis of infertile men. Fertil Steril 2000.
Fertility and Sterility  , DOI: ( /S (00) )