1. Volume 12, Issue 5, Pages 985-990 (November 2005)
Promoter Dependence of Plasmid–Pluronics Targeted α Galactosidase A Expression in Skeletal Muscle of Fabry Mice 
Matthieu D. Lavigne, Marita Pohlschmidt, Javier F. Novo, Bernard Higgins, Valery Alakhov, Hanns Lochmuller, Hitoshi Sakuraba, Geoffrey Goldspink, Kay MacDermot, Dariusz C. Górecki 
Molecular Therapy 
Volume 12, Issue 5, Pages (November 2005)
DOI: /j.ymthe
Copyright © 2005 The American Society of Gene Therapy Terms and Conditions

2. Fig. 1
AGA enzymatic activity in Fabry mouse muscle following injection of plasmid vectors alone or in combination with Pluronic SP1017. (A) The AGA activity in muscle extracts (nmol/h/mg of protein) 1 to 5 weeks postinjection with pX61 (black columns) or pX61MCK (white columns). There were significant differences (P < 0.001) between the pX61 and the pX61MCK levels at 3 and 5 weeks postinjection, as enzyme activity declined drastically when the pX61 construct was used. (B) The comparison of relative enzyme activities (% of values obtained for pX61 at 1 week) in muscle extracts from animals treated with cyclophosphamide (CY) following injection of pX61. CY treatment prevented the decline in AGA activity; there was no statistically significant difference (P = 0.41) in AGA values between the group analyzed 1 week postinjection and the group treated with CY and analyzed 3 weeks postinjection (n > 5). (C) The AGA activity in muscle extracts (nmol/h/mg of protein) 1 and 3 weeks postinjection with pX61 (black columns) or pX61MCK (white columns) used in combination with Pluronic SP1017. There was a significant increase in AGA expression over naked plasmid only when SP1017 was used with pX61 (P < 0.005) and no effect when Pluronic SP1017 was combined with pX61MCK (P = 0.310). This increase in expression using SP1017 was short in duration; activity decreased drastically (2 logs) as for naked pX61. All values are presented as means ± SEM. Plasmid construct pX61 containing the human AGA cDNA controlled by the human CMV immediate-early promoter region and the rat myosin light-chain 1/3 enhancer [25] was modified into pX61MCK plasmid, in which the short version (1.35 kb) of the muscle creatine kinase promoter/enhancer was substituted for the CMV promoter. The 1.35-kb fragment containing the region −1354 to +1 bp of MCK was PCR-amplified from pAdMCKBecker2 vector [11] using primers GCAGTTACGCGTCTGCTGCGGGTCTCATCGTA and GCAGTTGGGTGACCCCGGAATTGAGCTCGGTAC, containing MluI and BstEII restriction sites, respectively, for cloning purposes. High-purity, endotoxin-free plasmid preparations were carried out using a Qiagen kit as described previously [25,26] and 4-week-old mice were injected with plasmid DNA resuspended in sterile physiological saline (2 mg/ml). The standard injection had a volume of 25 μl (50 μg of pDNA); it was administered aseptically into both tibialis anterior muscles in anesthetized (isoflurane) Fabry mice. Pluronic SP1017 solution (Supratek Pharma, Laval, QC, Canada) was combined with equal volumes of plasmid DNAs and gently mixed to get the required final concentrations of DNA (20 μg) and 0.01% w/v of SP1017 in 25 μl saline. The formulation was used immediately for im injection. Cyclophosphamide (150 mg/kg body wt) was administered intraperitoneally on days 2 and 9 postinjection of plasmids. For analysis of the AGA enzymatic activity, frozen muscle and livers were ground under liquid nitrogen using a drill method [26] and tissue powder was resuspended in 1× Reporter Lysis Buffer (Promega). The protein concentrations were measured using the bicinchoninic acid kit (Sigma). The enzyme activity in muscle and liver tissue was measured fluorimetrically as described before [25]. Data were analyzed using analysis of variance for repeated measures. The quoted P values were derived using multiple comparisons based upon Fisher's least significant difference.
Molecular Therapy  , DOI: ( /j.ymthe )
Copyright © 2005 The American Society of Gene Therapy Terms and Conditions

3. Fig. 2
Serum levels of anti-hAGA antibodies following injection of plasmid vectors into Fabry mouse muscles. Sera of mice injected with pX61 or pX61MCK were assayed for anti-AGA antibodies at weeks 0, 1, 2, 3, and 5 postinjection. A significant difference (P = 0.005) in anti-AGA titers between pX61 and pX61MCK sera over time could be observed. Moreover, there was a delay in the initiation of the antibody production in the pX61MCK group (1 to 2 weeks for pX61 vs 3 weeks for pX61MCK). Levels of hAGA-specific antibodies were measured using ELISA [27]. Maxisorp plates (Nunc) were coated with highly purified recombinant human AGA (0.5 μg/well). Each sample was measured in duplicate. Bound anti-AGA Abs were detected using horseradish peroxidase-conjugated sheep anti-mouse IgG (1/500; Amersham) and a substrate mix containing TMB and H2O2 (Sigma). Titers were defined as the reciprocal of the highest dilution of serum that produced an OD450 equal to Values are presented as means ± SEM.
Molecular Therapy  , DOI: ( /j.ymthe )
Copyright © 2005 The American Society of Gene Therapy Terms and Conditions

4. Fig. 3
Analysis of CD8+ lymphocyte and macrophage infiltrates following injection of plasmid vectors into Fabry mouse muscles. Plasmid vectors (A, C, E, G, I, K) pX61MCK and (B, D, F, H, J, L) pX61 were injected into TA muscles of 4-week-old Fabry mice and muscle sections were taken 2 weeks postinjection. (A–F) Immunolocalization of CD8+ T cells. Red fluorescence signal corresponds to CD8+ expression on cytotoxic T lymphocytes infiltrating injected muscle; nuclear counterstaining (YOPRO-1) is shown in green. (I–N) Immunolocalization of macrophages. Purple staining denotes macrophage-specific staining; nuclear counterstaining (methyl green) is in blue-green. (G, H, O, and P) Serum-only negative controls. Note the significant number of CD8+ cells and macrophages infiltrating muscle fibers injected with pX61 at 2 weeks postinjection compared to no staining in muscle injected with pX61MCK at any time point or with pX61 at 5 weeks postinjection. For detection of CD8+ T cells rat anti-mouse CD8 antibody (Serotec; YTS 169.4) was used (1/500 in 10% goat serum) with chicken anti-rat IgG conjugated with Alexa Fluor 647 (1/200 in 2% goat serum) secondary detection and YOPRO-1 (both from Molecular Probes) cell nucleus counterstaining. Samples were analyzed using an LSM 510 confocal microscope (Zeiss), with excitation at 650 and 488 nm and emission at 668 and 510 nm for Alexa and YOPRO-1, respectively. For detection of macrophages, rat anti-mouse F4/80 biotinylated antibody (Serotec; MCA 497B) was used (1/100 in 10% goat serum) with immunohistochemical visualization (VECTAstain and VIP kits; Vector Laboratories). In both cases negative controls were incubated with 10% goat serum only.
Molecular Therapy  , DOI: ( /j.ymthe )
Copyright © 2005 The American Society of Gene Therapy Terms and Conditions