Presentation is loading. Please wait.

Presentation is loading. Please wait.

Beginning of the chapter Epigenetics and genetics

Similar presentations


Presentation on theme: "Beginning of the chapter Epigenetics and genetics"— Presentation transcript:

1 Beginning of the chapter Epigenetics and genetics
18 Beginning of the chapter Epigenetics and genetics

2 GENETICS Epi-Genetics

3 Genetics - blueprint of the body
EPIGENETICS What is epigenetics? Genetics - blueprint of the body Instruction: How is food digested? Instruction: How are blood sugar levels regulated? Instruction: What color should eyes have? Instruction: How are strong bones built? Gene defective >> missing function of the body >> disease Epigenetics - "volume control" for the genes Environmental factors turn genes on (make them LOUDER) Environmental factors turn genes off (they make QUIETER) „Louder“ und „Quieter“ genes influence processes in the body Epigenetic programming can be inherited

4 EPIGENETICS What is epigenetics? 1944 Netherlands 1947 Netherlands
1997 Netherlands 2013 Netherlands Famine 400kcal/Day Heart disease Breast cancer Obesity Heart disease Breast cancer Obesity Environmental impact on the mother in 1944 influences the health of the descendants two generations later

5 How does epigenetics work?
Lactose digestion Lactose digestion GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG Heterochromatin

6 How does epigenetics work?
Famine 400kcal/Tag Function A Function B Function C Function D Function E Function F

7 How does epigenetics work?

8 How does epigenetics work?
If epigenetics can turn on or off different genes, doesn‘t this overrule the genetic defects? Lactose digestion GTCTTACTTAGCCCTTTAAAGATCGAATCCGCGGCAGAATACATCGAAGGATTCGCTATATTAGG Answer: Some genetic defects destroy the instructions for the body. These instructions are completely lost, and cannot be recovered by epigenetics. >> Gene mutations cause severe diseases

9 Epigenetics and genetics
18 End of the chapter Epigenetics and genetics


Download ppt "Beginning of the chapter Epigenetics and genetics"

Similar presentations


Ads by Google